Incidental Mutation 'R0688:Olfr52'
ID61213
Institutional Source Beutler Lab
Gene Symbol Olfr52
Ensembl Gene ENSMUSG00000075199
Gene Nameolfactory receptor 52
SynonymsIE6, MOR185-6, GA_x6K02T2Q125-47650922-47649963
MMRRC Submission 038873-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R0688 (G1)
Quality Score110
Status Not validated
Chromosome2
Chromosomal Location86179412-86185683 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 86181605 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099905] [ENSMUST00000215138] [ENSMUST00000215171]
Predicted Effect probably damaging
Transcript: ENSMUST00000099905
AA Change: C169S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097489
Gene: ENSMUSG00000075199
AA Change: C169S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5e-56 PFAM
Pfam:7tm_1 41 290 3.4e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215138
AA Change: C169S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably null
Transcript: ENSMUST00000215171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215739
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T G 9: 104,124,100 V615G probably damaging Het
Apaf1 T G 10: 91,061,705 E305D possibly damaging Het
Apol10b A G 15: 77,585,219 S253P probably damaging Het
Bbs9 T A 9: 22,567,719 C153S probably damaging Het
Bicra C T 7: 15,989,322 G90D probably damaging Het
Clca4a A C 3: 144,961,974 L412R probably damaging Het
Cul3 A T 1: 80,271,564 D597E possibly damaging Het
Cxcr5 A G 9: 44,513,667 probably null Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Focad T A 4: 88,274,213 V593D unknown Het
Fsip2 T A 2: 82,982,339 S3001T probably benign Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gdf9 T A 11: 53,436,640 L141Q probably damaging Het
Gm13083 T C 4: 143,617,357 F409S probably benign Het
Gm4450 T C 3: 98,456,394 E45G probably benign Het
Gpr180 A G 14: 118,148,184 D136G probably benign Het
Itga2 G T 13: 114,839,554 A1094E probably benign Het
Ly75 C T 2: 60,316,221 A1238T probably benign Het
Macc1 T C 12: 119,447,003 V502A probably damaging Het
Mroh4 T C 15: 74,606,678 K923E probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Myo18a A G 11: 77,824,140 D474G probably damaging Het
Npat T A 9: 53,570,222 Y1077N probably benign Het
Olfr1214 A T 2: 88,987,595 S202R probably damaging Het
Olfr427 A C 1: 174,100,064 H202P probably damaging Het
Olfr816 T G 10: 129,911,883 T132P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Phyhipl C T 10: 70,559,255 G329R probably damaging Het
Pomgnt1 T C 4: 116,155,889 Y430H probably damaging Het
Prkd3 A T 17: 78,957,233 M651K probably damaging Het
Puf60 A T 15: 76,070,774 M440K probably damaging Het
Recql4 A G 15: 76,709,809 probably null Het
Sgk1 A C 10: 21,998,160 M320L probably benign Het
Slc27a4 T C 2: 29,812,615 F509S probably damaging Het
Sorbs1 T C 19: 40,363,262 T235A probably damaging Het
Srrm3 A G 5: 135,869,276 probably benign Het
Tex15 C T 8: 33,573,500 T986I probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zswim4 T C 8: 84,228,888 M301V possibly damaging Het
Other mutations in Olfr52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02238:Olfr52 APN 2 86181595 unclassified probably null
R0422:Olfr52 UTSW 2 86181222 missense probably benign 0.00
R0976:Olfr52 UTSW 2 86181808 missense probably damaging 0.99
R1240:Olfr52 UTSW 2 86182109 start codon destroyed possibly damaging 0.94
R1316:Olfr52 UTSW 2 86181365 missense probably benign 0.01
R1865:Olfr52 UTSW 2 86181538 missense probably damaging 1.00
R2188:Olfr52 UTSW 2 86181436 missense probably damaging 1.00
R4072:Olfr52 UTSW 2 86181647 missense probably benign 0.02
R4222:Olfr52 UTSW 2 86181997 missense probably damaging 0.99
R5096:Olfr52 UTSW 2 86181932 missense probably damaging 1.00
R5103:Olfr52 UTSW 2 86181616 missense probably benign 0.41
R5934:Olfr52 UTSW 2 86182102 missense probably benign 0.00
R6168:Olfr52 UTSW 2 86181965 missense probably damaging 0.99
R6601:Olfr52 UTSW 2 86181965 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGAGCGCATCCTCAGAATG -3'
(R):5'- TCGCAAGGAGTTAAAGATGCCCC -3'

Sequencing Primer
(F):5'- CATCCTCAGAATGGCAGAAATAATG -3'
(R):5'- TTCACAGCAATAGGCAATCTGG -3'
Posted On2013-07-30