Incidental Mutation 'R0688:Ugcg'
ID61220
Institutional Source Beutler Lab
Gene Symbol Ugcg
Ensembl Gene ENSMUSG00000028381
Gene NameUDP-glucose ceramide glucosyltransferase
SynonymsEpcs21, Ugcgl, GlcT-1
MMRRC Submission 038873-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0688 (G1)
Quality Score101
Status Not validated
Chromosome4
Chromosomal Location59189257-59222833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59207798 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 46 (P46S)
Ref Sequence ENSEMBL: ENSMUSP00000030074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030074]
Predicted Effect probably benign
Transcript: ENSMUST00000030074
AA Change: P46S

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030074
Gene: ENSMUSG00000028381
AA Change: P46S

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 51 278 1.3e-26 PFAM
Pfam:Glyco_transf_21 106 278 8.4e-61 PFAM
Pfam:Glyco_trans_2_3 139 368 9.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155153
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the first glycosylation step in the biosynthesis of glycosphingolipids, which are membrane components containing lipid and sugar moieties. The product of this reaction is glucosylceramide, which is the core structure of many glycosphingolipids. [provided by RefSeq, Dec 2014]
PHENOTYPE: At embryonic day 7.5, embryos homozygous for a null mutation exhibit decreased size, markedly reduced extraembryonic tissues and a large increase in cells undergoing apoptosis. Mutants die by embryonic day 8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T G 9: 104,124,100 V615G probably damaging Het
Apaf1 T G 10: 91,061,705 E305D possibly damaging Het
Apol10b A G 15: 77,585,219 S253P probably damaging Het
Bbs9 T A 9: 22,567,719 C153S probably damaging Het
Bicra C T 7: 15,989,322 G90D probably damaging Het
Clca4a A C 3: 144,961,974 L412R probably damaging Het
Cul3 A T 1: 80,271,564 D597E possibly damaging Het
Cxcr5 A G 9: 44,513,667 probably null Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Focad T A 4: 88,274,213 V593D unknown Het
Fsip2 T A 2: 82,982,339 S3001T probably benign Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gdf9 T A 11: 53,436,640 L141Q probably damaging Het
Gm13083 T C 4: 143,617,357 F409S probably benign Het
Gm4450 T C 3: 98,456,394 E45G probably benign Het
Gpr180 A G 14: 118,148,184 D136G probably benign Het
Itga2 G T 13: 114,839,554 A1094E probably benign Het
Ly75 C T 2: 60,316,221 A1238T probably benign Het
Macc1 T C 12: 119,447,003 V502A probably damaging Het
Mroh4 T C 15: 74,606,678 K923E probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Myo18a A G 11: 77,824,140 D474G probably damaging Het
Npat T A 9: 53,570,222 Y1077N probably benign Het
Olfr1214 A T 2: 88,987,595 S202R probably damaging Het
Olfr427 A C 1: 174,100,064 H202P probably damaging Het
Olfr52 A T 2: 86,181,605 probably null Het
Olfr816 T G 10: 129,911,883 T132P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Phyhipl C T 10: 70,559,255 G329R probably damaging Het
Pomgnt1 T C 4: 116,155,889 Y430H probably damaging Het
Prkd3 A T 17: 78,957,233 M651K probably damaging Het
Puf60 A T 15: 76,070,774 M440K probably damaging Het
Recql4 A G 15: 76,709,809 probably null Het
Sgk1 A C 10: 21,998,160 M320L probably benign Het
Slc27a4 T C 2: 29,812,615 F509S probably damaging Het
Sorbs1 T C 19: 40,363,262 T235A probably damaging Het
Srrm3 A G 5: 135,869,276 probably benign Het
Tex15 C T 8: 33,573,500 T986I probably damaging Het
Zswim4 T C 8: 84,228,888 M301V possibly damaging Het
Other mutations in Ugcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Ugcg APN 4 59213865 missense possibly damaging 0.94
IGL01768:Ugcg APN 4 59217216 critical splice donor site probably null
IGL02636:Ugcg APN 4 59207763 missense possibly damaging 0.73
IGL02672:Ugcg APN 4 59218587 splice site probably benign
IGL02798:Ugcg APN 4 59220346 missense probably damaging 1.00
R0013:Ugcg UTSW 4 59213931 missense possibly damaging 0.82
R0013:Ugcg UTSW 4 59213931 missense possibly damaging 0.82
R0068:Ugcg UTSW 4 59217130 missense probably benign 0.16
R0068:Ugcg UTSW 4 59217130 missense probably benign 0.16
R0119:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0230:Ugcg UTSW 4 59189739 nonsense probably null
R0299:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0384:Ugcg UTSW 4 59220387 missense possibly damaging 0.91
R0499:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0645:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0726:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0802:Ugcg UTSW 4 59189685 missense probably benign 0.00
R0803:Ugcg UTSW 4 59189685 missense probably benign 0.00
R0811:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0812:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0828:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0831:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0944:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0945:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0947:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1104:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1209:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1210:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1252:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1253:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1255:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1488:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1490:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1548:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1698:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1771:Ugcg UTSW 4 59207775 missense probably benign 0.05
R1776:Ugcg UTSW 4 59207775 missense probably benign 0.05
R1781:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1794:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1840:Ugcg UTSW 4 59219517 missense probably damaging 1.00
R1942:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2228:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2229:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2237:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2239:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2314:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2337:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2338:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2340:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2422:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2426:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2433:Ugcg UTSW 4 59207876 missense possibly damaging 0.89
R2680:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3076:Ugcg UTSW 4 59213922 missense probably damaging 1.00
R3078:Ugcg UTSW 4 59213922 missense probably damaging 1.00
R3689:Ugcg UTSW 4 59211883 missense probably benign 0.16
R3732:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3732:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3733:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3766:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3767:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3768:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3769:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3771:Ugcg UTSW 4 59189690 missense probably benign
R3847:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3848:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3916:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3917:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3958:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3959:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4023:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4024:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4025:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4065:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4066:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4427:Ugcg UTSW 4 59219555 missense probably benign 0.02
R5842:Ugcg UTSW 4 59219545 missense possibly damaging 0.93
R6012:Ugcg UTSW 4 59220272 missense probably damaging 0.96
R6080:Ugcg UTSW 4 59218524 missense possibly damaging 0.70
R6762:Ugcg UTSW 4 59219530 missense possibly damaging 0.86
Y4336:Ugcg UTSW 4 59207798 missense probably benign 0.17
Y4337:Ugcg UTSW 4 59207798 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGGTTTCCTTGTCAGAAAGATGTCAGC -3'
(R):5'- TAAGCCCACGATGTAGCCCATCTC -3'

Sequencing Primer
(F):5'- cccccctcttcaaacaaaaac -3'
(R):5'- GTAGCCCATCTCTCATAGGGATAG -3'
Posted On2013-07-30