Incidental Mutation 'R0688:Cxcr5'
ID61236
Institutional Source Beutler Lab
Gene Symbol Cxcr5
Ensembl Gene ENSMUSG00000047880
Gene Namechemokine (C-X-C motif) receptor 5
SynonymsGpcr6, CXCR-5, Blr1
MMRRC Submission 038873-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R0688 (G1)
Quality Score106
Status Not validated
Chromosome9
Chromosomal Location44511787-44561877 bp(-) (GRCm38)
Type of Mutationunclassified (3245 bp from exon)
DNA Base Change (assembly) A to G at 44513667 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062215] [ENSMUST00000074989] [ENSMUST00000179828] [ENSMUST00000215293] [ENSMUST00000215661] [ENSMUST00000218183] [ENSMUST00000220303]
Predicted Effect probably damaging
Transcript: ENSMUST00000062215
AA Change: L231P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000050444
Gene: ENSMUSG00000047880
AA Change: L231P

DomainStartEndE-ValueType
Pfam:7tm_1 70 324 8.9e-62 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000074989
SMART Domains Protein: ENSMUSP00000074516
Gene: ENSMUSG00000063382

DomainStartEndE-ValueType
low complexity region 215 234 N/A INTRINSIC
PDB:2XB1|C 236 269 2e-14 PDB
low complexity region 278 292 N/A INTRINSIC
low complexity region 297 325 N/A INTRINSIC
low complexity region 337 376 N/A INTRINSIC
Pfam:BCL9 395 432 2.4e-18 PFAM
low complexity region 490 507 N/A INTRINSIC
low complexity region 521 534 N/A INTRINSIC
low complexity region 546 560 N/A INTRINSIC
low complexity region 590 602 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
low complexity region 835 852 N/A INTRINSIC
low complexity region 1042 1059 N/A INTRINSIC
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1167 1178 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000179828
AA Change: L231P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137518
Gene: ENSMUSG00000047880
AA Change: L231P

DomainStartEndE-ValueType
Pfam:7tm_1 70 324 1.7e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215293
AA Change: L231P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000215661
Predicted Effect probably null
Transcript: ENSMUST00000218183
Predicted Effect probably null
Transcript: ENSMUST00000220303
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-pass membrane protein that belongs to the CXC chemokine receptor family. It is expressed in mature B-cells and Burkitt's lymphoma. This cytokine receptor binds to B-lymphocyte chemoattractant (BLC), and is involved in B-cell migration into B-cell follicles of spleen and Peyer patches. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mutants lack inguinal lymph nodes, have a few abnormal or no Peyer's patches, morphologically altered primary lymphoid follicles and no functional germinal centers in their spleen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T G 9: 104,124,100 V615G probably damaging Het
Apaf1 T G 10: 91,061,705 E305D possibly damaging Het
Apol10b A G 15: 77,585,219 S253P probably damaging Het
Bbs9 T A 9: 22,567,719 C153S probably damaging Het
Bicra C T 7: 15,989,322 G90D probably damaging Het
Clca4a A C 3: 144,961,974 L412R probably damaging Het
Cul3 A T 1: 80,271,564 D597E possibly damaging Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Focad T A 4: 88,274,213 V593D unknown Het
Fsip2 T A 2: 82,982,339 S3001T probably benign Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gdf9 T A 11: 53,436,640 L141Q probably damaging Het
Gm13083 T C 4: 143,617,357 F409S probably benign Het
Gm4450 T C 3: 98,456,394 E45G probably benign Het
Gpr180 A G 14: 118,148,184 D136G probably benign Het
Itga2 G T 13: 114,839,554 A1094E probably benign Het
Ly75 C T 2: 60,316,221 A1238T probably benign Het
Macc1 T C 12: 119,447,003 V502A probably damaging Het
Mroh4 T C 15: 74,606,678 K923E probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Myo18a A G 11: 77,824,140 D474G probably damaging Het
Npat T A 9: 53,570,222 Y1077N probably benign Het
Olfr1214 A T 2: 88,987,595 S202R probably damaging Het
Olfr427 A C 1: 174,100,064 H202P probably damaging Het
Olfr52 A T 2: 86,181,605 probably null Het
Olfr816 T G 10: 129,911,883 T132P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Phyhipl C T 10: 70,559,255 G329R probably damaging Het
Pomgnt1 T C 4: 116,155,889 Y430H probably damaging Het
Prkd3 A T 17: 78,957,233 M651K probably damaging Het
Puf60 A T 15: 76,070,774 M440K probably damaging Het
Recql4 A G 15: 76,709,809 probably null Het
Sgk1 A C 10: 21,998,160 M320L probably benign Het
Slc27a4 T C 2: 29,812,615 F509S probably damaging Het
Sorbs1 T C 19: 40,363,262 T235A probably damaging Het
Srrm3 A G 5: 135,869,276 probably benign Het
Tex15 C T 8: 33,573,500 T986I probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zswim4 T C 8: 84,228,888 M301V possibly damaging Het
Other mutations in Cxcr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Cxcr5 APN 9 44514310 unclassified probably benign
IGL02850:Cxcr5 APN 9 44514106 missense probably damaging 1.00
Brimming UTSW 9 44513386 missense possibly damaging 0.90
R0326:Cxcr5 UTSW 9 44513281 missense probably benign
R4585:Cxcr5 UTSW 9 44514145 missense probably benign 0.40
R4784:Cxcr5 UTSW 9 44513341 missense probably benign 0.00
R4785:Cxcr5 UTSW 9 44513341 missense probably benign 0.00
R5104:Cxcr5 UTSW 9 44513319 missense probably benign 0.22
R5659:Cxcr5 UTSW 9 44513393 missense probably benign 0.01
R6488:Cxcr5 UTSW 9 44513979 missense probably damaging 0.98
R7088:Cxcr5 UTSW 9 44513386 missense possibly damaging 0.90
X0026:Cxcr5 UTSW 9 44513367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTGCTATTCACAGCCTTCAGCC -3'
(R):5'- AGCCATCGTCCATGCTGTTCAC -3'

Sequencing Primer
(F):5'- AGCCTCTCCAGTGTATCTAGGAAG -3'
(R):5'- ACCTGCACGGCCATTTG -3'
Posted On2013-07-30