Incidental Mutation 'R0688:Olfr816'
ID61245
Institutional Source Beutler Lab
Gene Symbol Olfr816
Ensembl Gene ENSMUSG00000063715
Gene Nameolfactory receptor 816
SynonymsGA_x6K02T2PULF-11590830-11589892, MOR113-1
MMRRC Submission 038873-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R0688 (G1)
Quality Score87
Status Not validated
Chromosome10
Chromosomal Location129909163-129915597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 129911883 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 132 (T132P)
Ref Sequence ENSEMBL: ENSMUSP00000149515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071605] [ENSMUST00000213438]
Predicted Effect probably damaging
Transcript: ENSMUST00000071605
AA Change: T132P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071534
Gene: ENSMUSG00000063715
AA Change: T132P

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 6.9e-50 PFAM
Pfam:7tm_1 39 288 1.2e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213438
AA Change: T132P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213618
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T G 9: 104,124,100 V615G probably damaging Het
Apaf1 T G 10: 91,061,705 E305D possibly damaging Het
Apol10b A G 15: 77,585,219 S253P probably damaging Het
Bbs9 T A 9: 22,567,719 C153S probably damaging Het
Bicra C T 7: 15,989,322 G90D probably damaging Het
Clca4a A C 3: 144,961,974 L412R probably damaging Het
Cul3 A T 1: 80,271,564 D597E possibly damaging Het
Cxcr5 A G 9: 44,513,667 probably null Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Focad T A 4: 88,274,213 V593D unknown Het
Fsip2 T A 2: 82,982,339 S3001T probably benign Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gdf9 T A 11: 53,436,640 L141Q probably damaging Het
Gm13083 T C 4: 143,617,357 F409S probably benign Het
Gm4450 T C 3: 98,456,394 E45G probably benign Het
Gpr180 A G 14: 118,148,184 D136G probably benign Het
Itga2 G T 13: 114,839,554 A1094E probably benign Het
Ly75 C T 2: 60,316,221 A1238T probably benign Het
Macc1 T C 12: 119,447,003 V502A probably damaging Het
Mroh4 T C 15: 74,606,678 K923E probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Myo18a A G 11: 77,824,140 D474G probably damaging Het
Npat T A 9: 53,570,222 Y1077N probably benign Het
Olfr1214 A T 2: 88,987,595 S202R probably damaging Het
Olfr427 A C 1: 174,100,064 H202P probably damaging Het
Olfr52 A T 2: 86,181,605 probably null Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Phyhipl C T 10: 70,559,255 G329R probably damaging Het
Pomgnt1 T C 4: 116,155,889 Y430H probably damaging Het
Prkd3 A T 17: 78,957,233 M651K probably damaging Het
Puf60 A T 15: 76,070,774 M440K probably damaging Het
Recql4 A G 15: 76,709,809 probably null Het
Sgk1 A C 10: 21,998,160 M320L probably benign Het
Slc27a4 T C 2: 29,812,615 F509S probably damaging Het
Sorbs1 T C 19: 40,363,262 T235A probably damaging Het
Srrm3 A G 5: 135,869,276 probably benign Het
Tex15 C T 8: 33,573,500 T986I probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zswim4 T C 8: 84,228,888 M301V possibly damaging Het
Other mutations in Olfr816
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Olfr816 APN 10 129912245 missense possibly damaging 0.89
IGL01650:Olfr816 APN 10 129911681 missense probably benign 0.00
IGL01766:Olfr816 APN 10 129911780 missense probably damaging 1.00
IGL02738:Olfr816 APN 10 129911331 utr 3 prime probably benign
IGL02824:Olfr816 APN 10 129911696 missense probably damaging 1.00
R0401:Olfr816 UTSW 10 129911916 missense probably benign 0.18
R1589:Olfr816 UTSW 10 129911681 missense probably benign 0.00
R1744:Olfr816 UTSW 10 129911393 missense probably damaging 1.00
R2049:Olfr816 UTSW 10 129912167 missense probably benign 0.30
R3763:Olfr816 UTSW 10 129911445 missense probably damaging 1.00
R3952:Olfr816 UTSW 10 129911636 missense probably benign 0.00
R3971:Olfr816 UTSW 10 129911873 missense probably benign 0.01
R4557:Olfr816 UTSW 10 129911529 missense probably damaging 1.00
R5538:Olfr816 UTSW 10 129912002 missense probably benign 0.13
R6127:Olfr816 UTSW 10 129911415 missense probably damaging 1.00
R6227:Olfr816 UTSW 10 129911667 missense probably damaging 1.00
R6394:Olfr816 UTSW 10 129911920 missense probably damaging 1.00
R6707:Olfr816 UTSW 10 129911739 missense probably benign 0.02
R7257:Olfr816 UTSW 10 129912287 start gained probably benign
R7258:Olfr816 UTSW 10 129912287 start gained probably benign
R7260:Olfr816 UTSW 10 129912287 start gained probably benign
R7409:Olfr816 UTSW 10 129912251 missense possibly damaging 0.74
R7539:Olfr816 UTSW 10 129912063 missense probably damaging 1.00
X0019:Olfr816 UTSW 10 129912095 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTGTGTCTGTGCAAGAAATCTG -3'
(R):5'- AGCGTCACTGGAAATCTGACCATC -3'

Sequencing Primer
(F):5'- AATCTGAAGAAGTGGAGTTGTGTC -3'
(R):5'- CTGGTGGATACTCACCTGAAGAC -3'
Posted On2013-07-30