Incidental Mutation 'R0688:Itga2'
ID61251
Institutional Source Beutler Lab
Gene Symbol Itga2
Ensembl Gene ENSMUSG00000015533
Gene Nameintegrin alpha 2
SynonymsVLA-2 receptor, alpha 2 subunit, DX5, CD49B
MMRRC Submission 038873-MU
Accession Numbers

NCBI RefSeq: NM_008396.2; MGI: 96600

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0688 (G1)
Quality Score138
Status Not validated
Chromosome13
Chromosomal Location114833081-114932100 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 114839554 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 1094 (A1094E)
Ref Sequence ENSEMBL: ENSMUSP00000053891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056117]
Predicted Effect probably benign
Transcript: ENSMUST00000056117
AA Change: A1094E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000053891
Gene: ENSMUSG00000015533
AA Change: A1094E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Int_alpha 41 96 4.91e-4 SMART
VWA 169 359 2.42e-39 SMART
Blast:VWA 364 424 4e-26 BLAST
Int_alpha 430 481 2.59e-3 SMART
Int_alpha 484 541 3.5e-9 SMART
Int_alpha 547 602 3.11e-15 SMART
Int_alpha 611 669 2.52e-1 SMART
low complexity region 890 910 N/A INTRINSIC
transmembrane domain 1129 1151 N/A INTRINSIC
Pfam:Integrin_alpha 1152 1166 9e-7 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype Strain: 2675420;2183401
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha subunit of a transmembrane receptor for collagens and related proteins. The encoded protein forms a heterodimer with a beta subunit and mediates the adhesion of platelets and other cell types to the extracellular matrix. Loss of the encoded protein is associated with bleeding disorder platelet-type 9. Antibodies against this protein are found in several immune disorders, including neonatal alloimmune thrombocytopenia. This gene is located adjacent to a related alpha subunit gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygotes for targeted null mutations were viable, fertile, showed no overt anatomical defects, and exhibited no bleeding anomalies. Platelet, primary fibroblast and keratinocytes from homozygous mutant mice show less efficient adhesion to collagens in vitro. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T G 9: 104,124,100 V615G probably damaging Het
Apaf1 T G 10: 91,061,705 E305D possibly damaging Het
Apol10b A G 15: 77,585,219 S253P probably damaging Het
Bbs9 T A 9: 22,567,719 C153S probably damaging Het
Bicra C T 7: 15,989,322 G90D probably damaging Het
Clca4a A C 3: 144,961,974 L412R probably damaging Het
Cul3 A T 1: 80,271,564 D597E possibly damaging Het
Cxcr5 A G 9: 44,513,667 probably null Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Focad T A 4: 88,274,213 V593D unknown Het
Fsip2 T A 2: 82,982,339 S3001T probably benign Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gdf9 T A 11: 53,436,640 L141Q probably damaging Het
Gm13083 T C 4: 143,617,357 F409S probably benign Het
Gm4450 T C 3: 98,456,394 E45G probably benign Het
Gpr180 A G 14: 118,148,184 D136G probably benign Het
Ly75 C T 2: 60,316,221 A1238T probably benign Het
Macc1 T C 12: 119,447,003 V502A probably damaging Het
Mroh4 T C 15: 74,606,678 K923E probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Myo18a A G 11: 77,824,140 D474G probably damaging Het
Npat T A 9: 53,570,222 Y1077N probably benign Het
Olfr1214 A T 2: 88,987,595 S202R probably damaging Het
Olfr427 A C 1: 174,100,064 H202P probably damaging Het
Olfr52 A T 2: 86,181,605 probably null Het
Olfr816 T G 10: 129,911,883 T132P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Phyhipl C T 10: 70,559,255 G329R probably damaging Het
Pomgnt1 T C 4: 116,155,889 Y430H probably damaging Het
Prkd3 A T 17: 78,957,233 M651K probably damaging Het
Puf60 A T 15: 76,070,774 M440K probably damaging Het
Recql4 A G 15: 76,709,809 probably null Het
Sgk1 A C 10: 21,998,160 M320L probably benign Het
Slc27a4 T C 2: 29,812,615 F509S probably damaging Het
Sorbs1 T C 19: 40,363,262 T235A probably damaging Het
Srrm3 A G 5: 135,869,276 probably benign Het
Tex15 C T 8: 33,573,500 T986I probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zswim4 T C 8: 84,228,888 M301V possibly damaging Het
Other mutations in Itga2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Itga2 APN 13 114877625 missense probably damaging 0.99
IGL01481:Itga2 APN 13 114859632 missense possibly damaging 0.63
IGL01666:Itga2 APN 13 114837091 critical splice donor site probably null
IGL01730:Itga2 APN 13 114854411 splice site probably benign
IGL01965:Itga2 APN 13 114848064 splice site probably benign
IGL01987:Itga2 APN 13 114847946 nonsense probably null
IGL02334:Itga2 APN 13 114865309 critical splice donor site probably null
IGL02381:Itga2 APN 13 114856722 missense probably damaging 1.00
IGL02562:Itga2 APN 13 114836570 unclassified probably benign
IGL03191:Itga2 APN 13 114836484 unclassified probably benign
IGL03209:Itga2 APN 13 114880632 missense probably damaging 1.00
P0007:Itga2 UTSW 13 114866199 missense probably damaging 1.00
R0023:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0023:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0025:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0029:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0062:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0062:Itga2 UTSW 13 114870496 missense possibly damaging 0.90
R0149:Itga2 UTSW 13 114836579 unclassified probably benign
R0152:Itga2 UTSW 13 114866314 missense probably benign 0.06
R0496:Itga2 UTSW 13 114853899 missense probably benign 0.00
R0502:Itga2 UTSW 13 114845856 missense probably benign 0.15
R0599:Itga2 UTSW 13 114856650 splice site probably benign
R0704:Itga2 UTSW 13 114862375 missense possibly damaging 0.91
R0760:Itga2 UTSW 13 114859632 missense possibly damaging 0.63
R0811:Itga2 UTSW 13 114870614 missense possibly damaging 0.92
R0812:Itga2 UTSW 13 114870614 missense possibly damaging 0.92
R0836:Itga2 UTSW 13 114856679 missense probably damaging 0.99
R1196:Itga2 UTSW 13 114866155 critical splice donor site probably null
R1546:Itga2 UTSW 13 114849420 missense possibly damaging 0.63
R1639:Itga2 UTSW 13 114857296 missense probably benign 0.00
R1834:Itga2 UTSW 13 114856726 missense probably damaging 0.98
R1834:Itga2 UTSW 13 114856727 missense probably damaging 1.00
R2180:Itga2 UTSW 13 114849381 missense possibly damaging 0.67
R2190:Itga2 UTSW 13 114870605 missense probably benign 0.05
R2518:Itga2 UTSW 13 114881042 missense probably damaging 1.00
R3885:Itga2 UTSW 13 114869299 missense probably benign 0.35
R3962:Itga2 UTSW 13 114839518 missense probably damaging 0.99
R4094:Itga2 UTSW 13 114870625 missense probably benign 0.01
R4193:Itga2 UTSW 13 114886649 nonsense probably null
R4290:Itga2 UTSW 13 114866173 missense probably damaging 0.98
R4459:Itga2 UTSW 13 114843483 missense probably damaging 0.97
R4460:Itga2 UTSW 13 114843483 missense probably damaging 0.97
R4628:Itga2 UTSW 13 114877693 missense probably benign 0.03
R4655:Itga2 UTSW 13 114873269 missense probably benign 0.00
R4716:Itga2 UTSW 13 114857373 missense probably damaging 0.98
R4896:Itga2 UTSW 13 114853766 nonsense probably null
R5093:Itga2 UTSW 13 114856181 missense probably benign 0.00
R5488:Itga2 UTSW 13 114843435 missense probably damaging 1.00
R5489:Itga2 UTSW 13 114843435 missense probably damaging 1.00
R5743:Itga2 UTSW 13 114884506 missense probably damaging 1.00
R5767:Itga2 UTSW 13 114839570 missense possibly damaging 0.88
R5790:Itga2 UTSW 13 114868206 missense probably benign 0.02
R5923:Itga2 UTSW 13 114884519 missense probably benign 0.02
R6163:Itga2 UTSW 13 114866190 missense probably damaging 1.00
R6227:Itga2 UTSW 13 114839561 missense probably benign 0.30
R6278:Itga2 UTSW 13 114845888 missense probably benign 0.05
R6283:Itga2 UTSW 13 114869250 missense probably damaging 1.00
R6332:Itga2 UTSW 13 114843473 missense probably benign
R6510:Itga2 UTSW 13 114873280 missense probably damaging 1.00
R6742:Itga2 UTSW 13 114836525 missense possibly damaging 0.93
R6869:Itga2 UTSW 13 114875537 synonymous probably null
R7073:Itga2 UTSW 13 114859613 missense probably damaging 1.00
R7111:Itga2 UTSW 13 114900530 missense unknown
R7236:Itga2 UTSW 13 114877691 missense probably benign
R7269:Itga2 UTSW 13 114886689 nonsense probably null
R7350:Itga2 UTSW 13 114837202 missense probably damaging 0.98
R7375:Itga2 UTSW 13 114869217 missense probably benign 0.06
R7501:Itga2 UTSW 13 114875559 missense probably damaging 1.00
Z1088:Itga2 UTSW 13 114857332 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TCCTGCTTTAGGCATGACACATCAC -3'
(R):5'- CCAAAGGCTGCTCAGCAACTTCTC -3'

Sequencing Primer
(F):5'- CAAGCACATCTGGACTTTCTGAG -3'
(R):5'- TCTTTGTGGCAAGTTCAAGC -3'
Posted On2013-07-30