Incidental Mutation 'R0688:Prkd3'
ID61257
Institutional Source Beutler Lab
Gene Symbol Prkd3
Ensembl Gene ENSMUSG00000024070
Gene Nameprotein kinase D3
SynonymsPrkcn, 5730497N19Rik, PKD3, 4930557O20Rik
MMRRC Submission 038873-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R0688 (G1)
Quality Score183
Status Not validated
Chromosome17
Chromosomal Location78949405-79020816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78957233 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 651 (M651K)
Ref Sequence ENSEMBL: ENSMUSP00000132004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003191] [ENSMUST00000118768] [ENSMUST00000119284] [ENSMUST00000168887]
Predicted Effect probably damaging
Transcript: ENSMUST00000003191
AA Change: M651K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000003191
Gene: ENSMUSG00000024070
AA Change: M651K

DomainStartEndE-ValueType
C1 155 204 1.95e-13 SMART
C1 272 321 1.26e-16 SMART
PH 417 534 1.18e-10 SMART
S_TKc 575 831 4.5e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000118768
AA Change: M557K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113232
Gene: ENSMUSG00000024070
AA Change: M557K

DomainStartEndE-ValueType
C1 60 109 1.95e-13 SMART
C1 177 226 1.26e-16 SMART
PH 322 439 1.18e-10 SMART
S_TKc 481 737 4.5e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119284
AA Change: M652K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113395
Gene: ENSMUSG00000024070
AA Change: M652K

DomainStartEndE-ValueType
C1 155 204 1.95e-13 SMART
C1 272 321 1.26e-16 SMART
PH 417 534 1.18e-10 SMART
S_TKc 576 832 4.5e-90 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168887
AA Change: M651K

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132004
Gene: ENSMUSG00000024070
AA Change: M651K

DomainStartEndE-ValueType
C1 155 204 1.95e-13 SMART
C1 272 321 1.26e-16 SMART
PH 417 534 1.18e-10 SMART
S_TKc 575 831 4.5e-90 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the multigene protein kinase D family of serine/threonine kinases, which bind diacylglycerol and phorbol esters. Members of this family are characterized by an N-terminal regulatory domain comprised of a tandem repeat of cysteine-rich zinc-finger motifs and a pleckstrin domain. The C-terminal region contains the catalytic domain and is distantly related to calcium-regulated kinases. Catalytic activity of this enzyme promotes its nuclear localization. This protein has been implicated in a variety of functions including negative regulation of human airway epithelial barrier formation, growth regulation of breast and prostate cancer cells, and vesicle trafficking. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygous mutation of this gene results in abnormal vertebral trabecular bone morphology and abnormal femur morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 T G 9: 104,124,100 V615G probably damaging Het
Apaf1 T G 10: 91,061,705 E305D possibly damaging Het
Apol10b A G 15: 77,585,219 S253P probably damaging Het
Bbs9 T A 9: 22,567,719 C153S probably damaging Het
Bicra C T 7: 15,989,322 G90D probably damaging Het
Clca4a A C 3: 144,961,974 L412R probably damaging Het
Cul3 A T 1: 80,271,564 D597E possibly damaging Het
Cxcr5 A G 9: 44,513,667 probably null Het
Dnah10 T C 5: 124,747,718 I646T possibly damaging Het
Focad T A 4: 88,274,213 V593D unknown Het
Fsip2 T A 2: 82,982,339 S3001T probably benign Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gdf9 T A 11: 53,436,640 L141Q probably damaging Het
Gm13083 T C 4: 143,617,357 F409S probably benign Het
Gm4450 T C 3: 98,456,394 E45G probably benign Het
Gpr180 A G 14: 118,148,184 D136G probably benign Het
Itga2 G T 13: 114,839,554 A1094E probably benign Het
Ly75 C T 2: 60,316,221 A1238T probably benign Het
Macc1 T C 12: 119,447,003 V502A probably damaging Het
Mroh4 T C 15: 74,606,678 K923E probably damaging Het
Msh3 G A 13: 92,351,431 P93S possibly damaging Het
Myo18a A G 11: 77,824,140 D474G probably damaging Het
Npat T A 9: 53,570,222 Y1077N probably benign Het
Olfr1214 A T 2: 88,987,595 S202R probably damaging Het
Olfr427 A C 1: 174,100,064 H202P probably damaging Het
Olfr52 A T 2: 86,181,605 probably null Het
Olfr816 T G 10: 129,911,883 T132P probably damaging Het
Paqr5 T G 9: 61,972,794 T59P probably benign Het
Phyhipl C T 10: 70,559,255 G329R probably damaging Het
Pomgnt1 T C 4: 116,155,889 Y430H probably damaging Het
Puf60 A T 15: 76,070,774 M440K probably damaging Het
Recql4 A G 15: 76,709,809 probably null Het
Sgk1 A C 10: 21,998,160 M320L probably benign Het
Slc27a4 T C 2: 29,812,615 F509S probably damaging Het
Sorbs1 T C 19: 40,363,262 T235A probably damaging Het
Srrm3 A G 5: 135,869,276 probably benign Het
Tex15 C T 8: 33,573,500 T986I probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Zswim4 T C 8: 84,228,888 M301V possibly damaging Het
Other mutations in Prkd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Prkd3 APN 17 78954523 missense probably benign 0.00
IGL01775:Prkd3 APN 17 79012760 missense probably damaging 1.00
IGL01875:Prkd3 APN 17 78957206 missense possibly damaging 0.95
IGL01892:Prkd3 APN 17 78972501 missense probably benign 0.13
FR4304:Prkd3 UTSW 17 78975820 intron probably null
R0070:Prkd3 UTSW 17 78954510 missense probably damaging 1.00
R0070:Prkd3 UTSW 17 78954510 missense probably damaging 1.00
R0374:Prkd3 UTSW 17 78957215 missense probably null 1.00
R1112:Prkd3 UTSW 17 78966408 missense probably damaging 1.00
R1364:Prkd3 UTSW 17 78957258 missense probably damaging 1.00
R1382:Prkd3 UTSW 17 78957245 missense probably damaging 1.00
R1459:Prkd3 UTSW 17 78971367 missense probably damaging 1.00
R1522:Prkd3 UTSW 17 78952696 missense probably damaging 1.00
R1645:Prkd3 UTSW 17 78956520 critical splice donor site probably null
R2035:Prkd3 UTSW 17 78975373 critical splice donor site probably null
R2187:Prkd3 UTSW 17 78975554 missense probably benign
R2250:Prkd3 UTSW 17 78968078 missense probably benign 0.15
R2850:Prkd3 UTSW 17 78954596 missense possibly damaging 0.89
R3625:Prkd3 UTSW 17 78985304 missense probably damaging 1.00
R3773:Prkd3 UTSW 17 78959106 missense possibly damaging 0.52
R3973:Prkd3 UTSW 17 78959141 splice site probably benign
R4089:Prkd3 UTSW 17 78971388 missense possibly damaging 0.64
R4407:Prkd3 UTSW 17 78983558 missense probably damaging 1.00
R4453:Prkd3 UTSW 17 78983546 missense probably damaging 1.00
R4697:Prkd3 UTSW 17 78961171 missense probably benign 0.02
R4715:Prkd3 UTSW 17 78951937 missense possibly damaging 0.73
R4754:Prkd3 UTSW 17 78956614 missense probably damaging 1.00
R4955:Prkd3 UTSW 17 78952727 missense probably null 0.95
R5412:Prkd3 UTSW 17 78954711 missense possibly damaging 0.85
R6163:Prkd3 UTSW 17 78966355 missense possibly damaging 0.94
R6280:Prkd3 UTSW 17 78981931 missense probably damaging 0.97
R7074:Prkd3 UTSW 17 78974807 nonsense probably null
R7153:Prkd3 UTSW 17 78966355 missense probably benign 0.04
R7335:Prkd3 UTSW 17 78954566 missense probably damaging 0.99
R7492:Prkd3 UTSW 17 78962545 nonsense probably null
X0063:Prkd3 UTSW 17 78956613 missense probably damaging 1.00
X0066:Prkd3 UTSW 17 78961182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCCCAGTCCACACAAGATAGTTG -3'
(R):5'- TATGTCGGTCAGTGTCACGTACCC -3'

Sequencing Primer
(F):5'- ttcttctgacctacactgacac -3'
(R):5'- CTTTGTCTAATACAAAAGGAAGGGTG -3'
Posted On2013-07-30