Incidental Mutation 'R0690:Pmpca'
ID61313
Institutional Source Beutler Lab
Gene Symbol Pmpca
Ensembl Gene ENSMUSG00000026926
Gene Namepeptidase (mitochondrial processing) alpha
Synonyms4933435E07Rik, INPP5E, Alpha-MPP
MMRRC Submission 038875-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.884) question?
Stock #R0690 (G1)
Quality Score132
Status Validated
Chromosome2
Chromosomal Location26389339-26397122 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 26391097 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 150 (Y150N)
Ref Sequence ENSEMBL: ENSMUSP00000109727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028293] [ENSMUST00000076431] [ENSMUST00000077983] [ENSMUST00000114093] [ENSMUST00000114100] [ENSMUST00000114102] [ENSMUST00000139738]
Predicted Effect probably benign
Transcript: ENSMUST00000028293
SMART Domains Protein: ENSMUSP00000028293
Gene: ENSMUSG00000026927

DomainStartEndE-ValueType
coiled coil region 209 321 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000076431
AA Change: Y150N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075762
Gene: ENSMUSG00000026926
AA Change: Y150N

DomainStartEndE-ValueType
Pfam:Peptidase_M16 76 226 4.5e-47 PFAM
Pfam:Peptidase_M16_C 231 430 4.1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077983
SMART Domains Protein: ENSMUSP00000077133
Gene: ENSMUSG00000026927

DomainStartEndE-ValueType
coiled coil region 186 298 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114093
AA Change: Y150N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109727
Gene: ENSMUSG00000026926
AA Change: Y150N

DomainStartEndE-ValueType
Pfam:Peptidase_M16 76 226 1.6e-47 PFAM
Pfam:Peptidase_M16_C 231 420 9.6e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114100
SMART Domains Protein: ENSMUSP00000109735
Gene: ENSMUSG00000026927

DomainStartEndE-ValueType
coiled coil region 236 348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114102
SMART Domains Protein: ENSMUSP00000109737
Gene: ENSMUSG00000026927

DomainStartEndE-ValueType
coiled coil region 259 371 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133737
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134871
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135155
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137686
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139535
Predicted Effect probably benign
Transcript: ENSMUST00000139738
SMART Domains Protein: ENSMUSP00000121256
Gene: ENSMUSG00000026927

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140074
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152375
Meta Mutation Damage Score 0.386 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is found in the mitochondrion, where it represents the alpha subunit of a proteolytic heterodimer. This heterodimer is responsible for cleaving the transit peptide from nuclear-encoded mitochondrial proteins. Defects in this gene are a cause of spinocerebellar ataxia, autosomal recessive 2. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,969,808 probably benign Het
Abi3 T C 11: 95,833,634 probably benign Het
Adam2 T C 14: 66,057,646 N250S probably damaging Het
Agbl4 T A 4: 111,657,388 I532K probably benign Het
Agrn T G 4: 156,174,453 E905A probably damaging Het
Ahi1 A G 10: 20,970,843 probably benign Het
Aifm2 A G 10: 61,726,452 N89S probably benign Het
Arsj C T 3: 126,438,184 T193I probably damaging Het
Ascc2 T A 11: 4,682,933 V702E probably damaging Het
Avpr1b T C 1: 131,600,281 S181P probably damaging Het
Bcl7a G A 5: 123,351,940 V56I possibly damaging Het
Cd160 T A 3: 96,805,786 D54V probably damaging Het
Celsr2 C A 3: 108,414,977 R173M probably damaging Het
Cfap57 A G 4: 118,569,727 probably benign Het
Cfap69 G A 5: 5,663,951 T27I probably damaging Het
Chaf1b T C 16: 93,900,017 probably benign Het
Cldn8 C T 16: 88,562,639 V133M probably damaging Het
Col2a1 A T 15: 97,980,192 V954E unknown Het
Col6a4 T C 9: 106,028,187 probably benign Het
Col6a6 T C 9: 105,709,486 M1779V probably benign Het
Coq8b A G 7: 27,242,249 E253G probably benign Het
Ctse T C 1: 131,674,778 probably benign Het
Cyp2c29 T A 19: 39,309,726 N238K probably benign Het
Dcaf1 T A 9: 106,846,649 probably benign Het
Dcc A T 18: 71,809,204 probably benign Het
Dkk1 A G 19: 30,549,345 F12S probably benign Het
Dnah6 A G 6: 73,129,474 V1760A probably benign Het
Fam117b G A 1: 59,958,353 S288N possibly damaging Het
Fam216a A T 5: 122,367,646 M110K probably damaging Het
Frem3 T A 8: 80,613,952 I958N possibly damaging Het
Gab1 T A 8: 80,800,116 N118Y probably damaging Het
Gda T A 19: 21,409,887 I251L probably benign Het
Gli2 C A 1: 118,844,460 R505L probably damaging Het
Gm5093 A T 17: 46,439,738 I121N possibly damaging Het
Gpnmb C T 6: 49,048,015 S327L probably benign Het
Gpr156 T A 16: 37,992,141 Y280N probably damaging Het
Gria4 A G 9: 4,427,071 Y790H probably damaging Het
Guf1 C A 5: 69,566,352 probably null Het
H6pd T C 4: 149,982,573 E452G possibly damaging Het
Herc1 T A 9: 66,386,838 Y487* probably null Het
Ifi30 T A 8: 70,764,949 probably benign Het
Klf13 G A 7: 63,938,071 A159V possibly damaging Het
Med11 T A 11: 70,453,226 M124K possibly damaging Het
Myom3 A G 4: 135,788,426 probably benign Het
Nat2 A T 8: 67,501,804 I189F probably damaging Het
Nhlrc4 C G 17: 25,943,684 G30R probably damaging Het
Nkx3-2 G A 5: 41,762,127 R173C probably damaging Het
Nox3 T C 17: 3,695,564 N23S probably damaging Het
Npr2 A T 4: 43,646,991 Y708F probably damaging Het
Nsun2 A G 13: 69,629,542 N409S probably benign Het
Nucb2 T C 7: 116,535,851 probably benign Het
Olfr1105 A G 2: 87,033,882 F113S probably damaging Het
Olfr541 T C 7: 140,704,787 F179L possibly damaging Het
Olfr874 T C 9: 37,746,217 F28L probably benign Het
Orai2 A T 5: 136,161,599 V52D probably damaging Het
Pcyox1 A T 6: 86,394,442 M154K probably damaging Het
Pik3r4 C A 9: 105,653,976 T492K possibly damaging Het
Ppp1r12b G T 1: 134,876,082 S446R probably damaging Het
Ptpdc1 A G 13: 48,586,905 I289T probably benign Het
Pyroxd2 A G 19: 42,727,642 probably benign Het
Qrfpr G A 3: 36,189,559 T131M probably damaging Het
Rab33b A G 3: 51,493,417 Y104C probably damaging Het
Rad54l G T 4: 116,099,750 probably benign Het
Rad9a A T 19: 4,197,360 probably null Het
Slc1a5 A T 7: 16,786,904 M233L probably benign Het
Slc47a2 C T 11: 61,342,504 V67I possibly damaging Het
Slco1a5 T A 6: 142,268,278 Y39F probably benign Het
Slfn5 T C 11: 82,961,403 V785A probably damaging Het
Sp6 C T 11: 97,021,544 P28S possibly damaging Het
Sptbn5 A G 2: 120,062,675 probably null Het
Sry ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG Y: 2,662,944 probably benign Het
St8sia1 A G 6: 142,829,254 W200R probably damaging Het
Stxbp1 C A 2: 32,800,695 probably benign Het
Syne1 A G 10: 5,033,138 probably benign Het
Thbs3 T A 3: 89,220,165 I371N possibly damaging Het
Tll1 C T 8: 64,074,290 S399N probably damaging Het
Tmem209 A C 6: 30,505,834 C114G probably null Het
Tmem25 C T 9: 44,795,514 probably benign Het
Tmem8b T C 4: 43,674,562 I282T possibly damaging Het
Trdmt1 T A 2: 13,544,580 H18L probably benign Het
Trim63 A G 4: 134,316,405 T60A probably benign Het
Trpv2 T C 11: 62,584,676 probably null Het
Ubr2 A T 17: 46,938,653 I1591K probably damaging Het
Use1 A T 8: 71,367,065 probably benign Het
Zfp850 A T 7: 27,985,217 C35S possibly damaging Het
Other mutations in Pmpca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02164:Pmpca APN 2 26395569 missense probably benign
R0064:Pmpca UTSW 2 26395507 missense probably benign 0.00
R0064:Pmpca UTSW 2 26395507 missense probably benign 0.00
R0864:Pmpca UTSW 2 26393209 splice site probably null
R0893:Pmpca UTSW 2 26393218 unclassified probably benign
R1386:Pmpca UTSW 2 26392518 missense probably damaging 0.98
R4541:Pmpca UTSW 2 26390189 unclassified probably benign
R4580:Pmpca UTSW 2 26393335 missense probably damaging 1.00
R4967:Pmpca UTSW 2 26390308 missense probably damaging 1.00
R4970:Pmpca UTSW 2 26395166 missense probably damaging 1.00
R5112:Pmpca UTSW 2 26395166 missense probably damaging 1.00
R5161:Pmpca UTSW 2 26395171 critical splice donor site probably null
R5567:Pmpca UTSW 2 26390541 missense probably damaging 1.00
R5570:Pmpca UTSW 2 26390541 missense probably damaging 1.00
R6456:Pmpca UTSW 2 26395167 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCCTGAGTGAGAGACTTCCTC -3'
(R):5'- TTCAGCACTGGCACTCTCCAATG -3'

Sequencing Primer
(F):5'- CTGGTTCCAAAGTATCTCATGGAGAG -3'
(R):5'- CTCTCCAATGATTGGCACATGAG -3'
Posted On2013-07-30