Incidental Mutation 'R0690:Nsun2'
ID61365
Institutional Source Beutler Lab
Gene Symbol Nsun2
Ensembl Gene ENSMUSG00000021595
Gene NameNOL1/NOP2/Sun domain family member 2
SynonymsMisu
MMRRC Submission 038875-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.881) question?
Stock #R0690 (G1)
Quality Score173
Status Validated
Chromosome13
Chromosomal Location69533746-69635780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69629542 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 409 (N409S)
Ref Sequence ENSEMBL: ENSMUSP00000135455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022087] [ENSMUST00000109699] [ENSMUST00000176485]
Predicted Effect probably benign
Transcript: ENSMUST00000022087
AA Change: N378S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022087
Gene: ENSMUSG00000021595
AA Change: N378S

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 83 209 4.5e-19 PFAM
Pfam:Nol1_Nop2_Fmu 199 376 1.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109699
AA Change: N444S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105321
Gene: ENSMUSG00000021595
AA Change: N444S

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 169 428 3.2e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136932
Predicted Effect probably benign
Transcript: ENSMUST00000176485
AA Change: N409S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135455
Gene: ENSMUSG00000021595
AA Change: N409S

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 114 240 3.5e-19 PFAM
Pfam:Nol1_Nop2_Fmu 230 399 1.1e-23 PFAM
Meta Mutation Damage Score 0.05 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.1%
Validation Efficiency 97% (87/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a methyltransferase that catalyzes the methylation of cytosine to 5-methylcytosine (m5C) at position 34 of intron-containing tRNA(Leu)(CAA) precursors. This modification is necessary to stabilize the anticodon-codon pairing and correctly translate the mRNA. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous inactivation of this gene leads to decreased body size, male sterility, and hair cycle anomalies. Additional phenotypes may include reduced body fat, skeletal, craniofacial and eye defects, abnormal erythropoiesis, and altered energy expenditure and gas, glucose, and lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b T A 11: 109,969,808 probably benign Het
Abi3 T C 11: 95,833,634 probably benign Het
Adam2 T C 14: 66,057,646 N250S probably damaging Het
Agbl4 T A 4: 111,657,388 I532K probably benign Het
Agrn T G 4: 156,174,453 E905A probably damaging Het
Ahi1 A G 10: 20,970,843 probably benign Het
Aifm2 A G 10: 61,726,452 N89S probably benign Het
Arsj C T 3: 126,438,184 T193I probably damaging Het
Ascc2 T A 11: 4,682,933 V702E probably damaging Het
Avpr1b T C 1: 131,600,281 S181P probably damaging Het
Bcl7a G A 5: 123,351,940 V56I possibly damaging Het
Cd160 T A 3: 96,805,786 D54V probably damaging Het
Celsr2 C A 3: 108,414,977 R173M probably damaging Het
Cfap57 A G 4: 118,569,727 probably benign Het
Cfap69 G A 5: 5,663,951 T27I probably damaging Het
Chaf1b T C 16: 93,900,017 probably benign Het
Cldn8 C T 16: 88,562,639 V133M probably damaging Het
Col2a1 A T 15: 97,980,192 V954E unknown Het
Col6a4 T C 9: 106,028,187 probably benign Het
Col6a6 T C 9: 105,709,486 M1779V probably benign Het
Coq8b A G 7: 27,242,249 E253G probably benign Het
Ctse T C 1: 131,674,778 probably benign Het
Cyp2c29 T A 19: 39,309,726 N238K probably benign Het
Dcaf1 T A 9: 106,846,649 probably benign Het
Dcc A T 18: 71,809,204 probably benign Het
Dkk1 A G 19: 30,549,345 F12S probably benign Het
Dnah6 A G 6: 73,129,474 V1760A probably benign Het
Fam117b G A 1: 59,958,353 S288N possibly damaging Het
Fam216a A T 5: 122,367,646 M110K probably damaging Het
Frem3 T A 8: 80,613,952 I958N possibly damaging Het
Gab1 T A 8: 80,800,116 N118Y probably damaging Het
Gda T A 19: 21,409,887 I251L probably benign Het
Gli2 C A 1: 118,844,460 R505L probably damaging Het
Gm5093 A T 17: 46,439,738 I121N possibly damaging Het
Gpnmb C T 6: 49,048,015 S327L probably benign Het
Gpr156 T A 16: 37,992,141 Y280N probably damaging Het
Gria4 A G 9: 4,427,071 Y790H probably damaging Het
Guf1 C A 5: 69,566,352 probably null Het
H6pd T C 4: 149,982,573 E452G possibly damaging Het
Herc1 T A 9: 66,386,838 Y487* probably null Het
Ifi30 T A 8: 70,764,949 probably benign Het
Klf13 G A 7: 63,938,071 A159V possibly damaging Het
Med11 T A 11: 70,453,226 M124K possibly damaging Het
Myom3 A G 4: 135,788,426 probably benign Het
Nat2 A T 8: 67,501,804 I189F probably damaging Het
Nhlrc4 C G 17: 25,943,684 G30R probably damaging Het
Nkx3-2 G A 5: 41,762,127 R173C probably damaging Het
Nox3 T C 17: 3,695,564 N23S probably damaging Het
Npr2 A T 4: 43,646,991 Y708F probably damaging Het
Nucb2 T C 7: 116,535,851 probably benign Het
Olfr1105 A G 2: 87,033,882 F113S probably damaging Het
Olfr541 T C 7: 140,704,787 F179L possibly damaging Het
Olfr874 T C 9: 37,746,217 F28L probably benign Het
Orai2 A T 5: 136,161,599 V52D probably damaging Het
Pcyox1 A T 6: 86,394,442 M154K probably damaging Het
Pik3r4 C A 9: 105,653,976 T492K possibly damaging Het
Pmpca T A 2: 26,391,097 Y150N probably damaging Het
Ppp1r12b G T 1: 134,876,082 S446R probably damaging Het
Ptpdc1 A G 13: 48,586,905 I289T probably benign Het
Pyroxd2 A G 19: 42,727,642 probably benign Het
Qrfpr G A 3: 36,189,559 T131M probably damaging Het
Rab33b A G 3: 51,493,417 Y104C probably damaging Het
Rad54l G T 4: 116,099,750 probably benign Het
Rad9a A T 19: 4,197,360 probably null Het
Slc1a5 A T 7: 16,786,904 M233L probably benign Het
Slc47a2 C T 11: 61,342,504 V67I possibly damaging Het
Slco1a5 T A 6: 142,268,278 Y39F probably benign Het
Slfn5 T C 11: 82,961,403 V785A probably damaging Het
Sp6 C T 11: 97,021,544 P28S possibly damaging Het
Sptbn5 A G 2: 120,062,675 probably null Het
Sry ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG ACTGCTGCTGCTGCTGCTGCTGCTGCTGCTG Y: 2,662,944 probably benign Het
St8sia1 A G 6: 142,829,254 W200R probably damaging Het
Stxbp1 C A 2: 32,800,695 probably benign Het
Syne1 A G 10: 5,033,138 probably benign Het
Thbs3 T A 3: 89,220,165 I371N possibly damaging Het
Tll1 C T 8: 64,074,290 S399N probably damaging Het
Tmem209 A C 6: 30,505,834 C114G probably null Het
Tmem25 C T 9: 44,795,514 probably benign Het
Tmem8b T C 4: 43,674,562 I282T possibly damaging Het
Trdmt1 T A 2: 13,544,580 H18L probably benign Het
Trim63 A G 4: 134,316,405 T60A probably benign Het
Trpv2 T C 11: 62,584,676 probably null Het
Ubr2 A T 17: 46,938,653 I1591K probably damaging Het
Use1 A T 8: 71,367,065 probably benign Het
Zfp850 A T 7: 27,985,217 C35S possibly damaging Het
Other mutations in Nsun2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Nsun2 APN 13 69623249 missense probably benign 0.01
IGL01997:Nsun2 APN 13 69623246 missense probably damaging 1.00
IGL02253:Nsun2 APN 13 69619539 missense possibly damaging 0.88
IGL03038:Nsun2 APN 13 69619584 missense probably damaging 1.00
IGL02984:Nsun2 UTSW 13 69543608 intron probably benign
PIT4494001:Nsun2 UTSW 13 69618192 critical splice donor site probably null
R0601:Nsun2 UTSW 13 69633242 missense probably benign 0.40
R0648:Nsun2 UTSW 13 69627587 missense probably damaging 1.00
R0718:Nsun2 UTSW 13 69543697 intron probably benign
R1501:Nsun2 UTSW 13 69631587 missense probably damaging 1.00
R1638:Nsun2 UTSW 13 69627586 missense probably damaging 1.00
R1678:Nsun2 UTSW 13 69627103 missense probably damaging 1.00
R1687:Nsun2 UTSW 13 69627597 missense probably damaging 1.00
R2327:Nsun2 UTSW 13 69619581 missense probably benign 0.44
R2872:Nsun2 UTSW 13 69629682 missense probably damaging 1.00
R2872:Nsun2 UTSW 13 69629682 missense probably damaging 1.00
R3689:Nsun2 UTSW 13 69612337 missense probably damaging 1.00
R3691:Nsun2 UTSW 13 69612337 missense probably damaging 1.00
R3739:Nsun2 UTSW 13 69629638 missense probably benign
R3918:Nsun2 UTSW 13 69630680 missense probably damaging 1.00
R4065:Nsun2 UTSW 13 69612460 critical splice donor site probably null
R4231:Nsun2 UTSW 13 69619541 missense probably damaging 1.00
R4445:Nsun2 UTSW 13 69629721 splice site probably null
R4872:Nsun2 UTSW 13 69543873 intron probably benign
R5641:Nsun2 UTSW 13 69623249 missense probably benign 0.01
R5718:Nsun2 UTSW 13 69623284 missense probably benign 0.19
R5976:Nsun2 UTSW 13 69623152 splice site probably null
R6110:Nsun2 UTSW 13 69627648 missense probably benign 0.01
R6943:Nsun2 UTSW 13 69630033 missense probably damaging 1.00
R6968:Nsun2 UTSW 13 69631290 missense probably benign 0.00
R7146:Nsun2 UTSW 13 69626553 critical splice donor site probably null
R7456:Nsun2 UTSW 13 69633606 missense probably damaging 0.98
X0064:Nsun2 UTSW 13 69615519 critical splice donor site probably null
Z1088:Nsun2 UTSW 13 69615465 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACCAAGAGCAGGCAGGCTCTAC -3'
(R):5'- GCTCTGGGACCCCATTTAGCTTAAC -3'

Sequencing Primer
(F):5'- GCTCTGAATTGAACAATGCCTG -3'
(R):5'- AGATAGTTCTGCTCAGATGGCAC -3'
Posted On2013-07-30