Incidental Mutation 'R0670:Celf3'
List |< first << previous [record 74 of 585] next >> last >|
ID61387
Institutional Source Beutler Lab
Gene Symbol Celf3
Ensembl Gene ENSMUSG00000028137
Gene NameCUGBP, Elav-like family member 3
SynonymsBRUNOL1, CAGH4, 4930415M08Rik, Tnrc4, ERDA4
MMRRC Submission 038855-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R0670 (G1)
Quality Score107
Status Not validated
Chromosome3
Chromosomal Location94478295-94492198 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) ACAGCAGCAGCAGCAGCAGCAGCA to ACAGCAGCAGCAGCAGCAGCA at 94488230 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029784] [ENSMUST00000197558] [ENSMUST00000197677] [ENSMUST00000198316] [ENSMUST00000198384] [ENSMUST00000199775] [ENSMUST00000199884] [ENSMUST00000200342]
Predicted Effect probably benign
Transcript: ENSMUST00000029784
SMART Domains Protein: ENSMUSP00000029784
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 8 84 4.32e-19 SMART
RRM 95 170 2.02e-19 SMART
low complexity region 208 220 N/A INTRINSIC
low complexity region 248 275 N/A INTRINSIC
low complexity region 339 373 N/A INTRINSIC
RRM 381 454 8.83e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197033
Predicted Effect probably benign
Transcript: ENSMUST00000197558
SMART Domains Protein: ENSMUSP00000143733
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 19 94 8.9e-22 SMART
low complexity region 132 144 N/A INTRINSIC
low complexity region 172 199 N/A INTRINSIC
RRM 286 359 3.7e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197677
SMART Domains Protein: ENSMUSP00000143089
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 20 95 8.7e-22 SMART
low complexity region 133 145 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198067
Predicted Effect probably benign
Transcript: ENSMUST00000198316
SMART Domains Protein: ENSMUSP00000142412
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 19 94 8.7e-22 SMART
low complexity region 132 144 N/A INTRINSIC
low complexity region 172 199 N/A INTRINSIC
low complexity region 263 297 N/A INTRINSIC
RRM 305 378 3.6e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198384
SMART Domains Protein: ENSMUSP00000142542
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 20 95 8.7e-22 SMART
low complexity region 133 145 N/A INTRINSIC
low complexity region 173 200 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199159
Predicted Effect probably benign
Transcript: ENSMUST00000199775
SMART Domains Protein: ENSMUSP00000143532
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 8 84 1.9e-21 SMART
RRM 96 171 8.9e-22 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 290 324 N/A INTRINSIC
RRM 332 405 3.7e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199884
Predicted Effect probably benign
Transcript: ENSMUST00000200342
SMART Domains Protein: ENSMUSP00000143344
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 8 84 4.32e-19 SMART
RRM 96 171 2.02e-19 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 249 276 N/A INTRINSIC
low complexity region 368 402 N/A INTRINSIC
RRM 410 483 8.83e-25 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Male mice homozygous for a null mutation display reduced sperm counts and motility but are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A T 2: 155,045,758 D46V probably damaging Het
Abraxas2 A T 7: 132,869,031 probably null Het
Afap1l2 G A 19: 56,915,803 T684I probably damaging Het
Ahcyl1 A T 3: 107,671,165 V205E probably damaging Het
Ap4e1 T A 2: 127,011,864 probably null Het
Brms1 C A 19: 5,045,971 N24K probably damaging Het
Col25a1 A G 3: 130,386,895 K130E possibly damaging Het
Crisp1 A C 17: 40,305,110 Y125* probably null Het
Dnhd1 A T 7: 105,696,464 D2272V possibly damaging Het
Elmod1 A G 9: 53,912,822 V294A probably damaging Het
Gm8909 G C 17: 36,168,098 F86L possibly damaging Het
Gmfg T A 7: 28,441,528 I33K probably damaging Het
Gsk3b G T 16: 38,144,316 D49Y probably damaging Het
Harbi1 C T 2: 91,712,535 R114W probably damaging Het
Hspbp1 A G 7: 4,677,736 V247A probably damaging Het
Kif17 A T 4: 138,262,499 probably benign Het
Klhl6 T A 16: 19,949,559 H412L possibly damaging Het
Muc1 A G 3: 89,230,532 D227G probably benign Het
Nat8f5 A T 6: 85,817,975 M1K probably null Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nfrkb A T 9: 31,420,173 Q1295L probably benign Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Pcdhb2 A T 18: 37,296,648 D558V probably damaging Het
Pdilt T C 7: 119,500,428 K206E probably benign Het
Pkn2 A T 3: 142,839,343 I23K probably damaging Het
Plec A T 15: 76,205,960 L60Q probably damaging Het
Ranbp2 C A 10: 58,480,698 D2413E probably benign Het
Socs1 A G 16: 10,784,262 Y204H probably damaging Het
Stk39 T C 2: 68,366,182 D301G possibly damaging Het
Tlr5 T A 1: 182,973,889 W253R probably damaging Het
Treml2 A G 17: 48,307,836 probably null Het
Ttn A G 2: 76,749,104 L22069P probably damaging Het
Vps13c G T 9: 67,925,857 S1614I probably benign Het
Vrk2 C T 11: 26,486,959 probably null Het
Xrn1 A G 9: 95,991,056 Y655C probably damaging Het
Other mutations in Celf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Celf3 APN 3 94488228 missense possibly damaging 0.70
IGL02103:Celf3 APN 3 94486801 missense probably damaging 1.00
IGL03007:Celf3 APN 3 94487137 missense probably benign 0.00
R0180:Celf3 UTSW 3 94485340 missense probably damaging 1.00
R1965:Celf3 UTSW 3 94485327 missense probably damaging 1.00
R2232:Celf3 UTSW 3 94480259 splice site probably null
R2566:Celf3 UTSW 3 94488230 small deletion probably benign
R3546:Celf3 UTSW 3 94488538 missense probably damaging 1.00
R3547:Celf3 UTSW 3 94488538 missense probably damaging 1.00
R3548:Celf3 UTSW 3 94488538 missense probably damaging 1.00
R4015:Celf3 UTSW 3 94487198 missense probably benign 0.02
R4471:Celf3 UTSW 3 94488278 splice site probably null
R4698:Celf3 UTSW 3 94484867 critical splice donor site probably null
R4816:Celf3 UTSW 3 94479222 missense probably damaging 1.00
R4939:Celf3 UTSW 3 94488230 small deletion probably benign
R5851:Celf3 UTSW 3 94479126 missense probably damaging 1.00
R6277:Celf3 UTSW 3 94485365 missense probably damaging 1.00
R6400:Celf3 UTSW 3 94480286 missense probably damaging 1.00
R6986:Celf3 UTSW 3 94487717 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- TTGTCTGAGGAAGCCTCATCCCTG -3'
(R):5'- ATTGGTGGCCCGGTCAACAAAG -3'

Sequencing Primer
(F):5'- GGCCTGTGGATTCCACTG -3'
(R):5'- CAAACATCTGGAGGATCTCTGAGTC -3'
Posted On2013-07-30