Incidental Mutation 'R0670:Nat8f5'
ID61392
Institutional Source Beutler Lab
Gene Symbol Nat8f5
Ensembl Gene ENSMUSG00000079494
Gene NameN-acetyltransferase 8 (GCN5-related) family member 5
Synonyms1810018F03Rik, Cml5
MMRRC Submission 038855-MU
Accession Numbers

Genbank: NM_023493; MGI: 1916299

Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R0670 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location85817218-85820972 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 85817975 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000032074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032074] [ENSMUST00000174143]
Predicted Effect probably null
Transcript: ENSMUST00000032074
AA Change: M1K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032074
Gene: ENSMUSG00000079494
AA Change: M1K

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:Acetyltransf_10 73 192 2.7e-12 PFAM
Pfam:Acetyltransf_9 79 195 9.1e-10 PFAM
Pfam:Acetyltransf_8 84 201 9.2e-10 PFAM
Pfam:Acetyltransf_4 84 205 9.2e-9 PFAM
Pfam:Acetyltransf_7 104 194 3.1e-11 PFAM
Pfam:Acetyltransf_1 111 193 1.6e-15 PFAM
Pfam:Acetyltransf_CG 121 184 1.6e-11 PFAM
Pfam:FR47 131 201 4.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174143
SMART Domains Protein: ENSMUSP00000133846
Gene: ENSMUSG00000079495

DomainStartEndE-ValueType
transmembrane domain 37 56 N/A INTRINSIC
Pfam:Acetyltransf_10 71 193 5.5e-11 PFAM
Pfam:Acetyltransf_4 75 202 1.1e-9 PFAM
Pfam:Acetyltransf_7 105 195 1.2e-10 PFAM
Pfam:Acetyltransf_1 112 194 2.6e-14 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit complex congenital heart disease associated with heterotaxy, abdominal organ situs anomalies, omphalocele and gastroschisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A T 2: 155,045,758 D46V probably damaging Het
Abraxas2 A T 7: 132,869,031 probably null Het
Afap1l2 G A 19: 56,915,803 T684I probably damaging Het
Ahcyl1 A T 3: 107,671,165 V205E probably damaging Het
Ap4e1 T A 2: 127,011,864 probably null Het
Brms1 C A 19: 5,045,971 N24K probably damaging Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Col25a1 A G 3: 130,386,895 K130E possibly damaging Het
Crisp1 A C 17: 40,305,110 Y125* probably null Het
Dnhd1 A T 7: 105,696,464 D2272V possibly damaging Het
Elmod1 A G 9: 53,912,822 V294A probably damaging Het
Gm8909 G C 17: 36,168,098 F86L possibly damaging Het
Gmfg T A 7: 28,441,528 I33K probably damaging Het
Gsk3b G T 16: 38,144,316 D49Y probably damaging Het
Harbi1 C T 2: 91,712,535 R114W probably damaging Het
Hspbp1 A G 7: 4,677,736 V247A probably damaging Het
Kif17 A T 4: 138,262,499 probably benign Het
Klhl6 T A 16: 19,949,559 H412L possibly damaging Het
Muc1 A G 3: 89,230,532 D227G probably benign Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nfrkb A T 9: 31,420,173 Q1295L probably benign Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Pcdhb2 A T 18: 37,296,648 D558V probably damaging Het
Pdilt T C 7: 119,500,428 K206E probably benign Het
Pkn2 A T 3: 142,839,343 I23K probably damaging Het
Plec A T 15: 76,205,960 L60Q probably damaging Het
Ranbp2 C A 10: 58,480,698 D2413E probably benign Het
Socs1 A G 16: 10,784,262 Y204H probably damaging Het
Stk39 T C 2: 68,366,182 D301G possibly damaging Het
Tlr5 T A 1: 182,973,889 W253R probably damaging Het
Treml2 A G 17: 48,307,836 probably null Het
Ttn A G 2: 76,749,104 L22069P probably damaging Het
Vps13c G T 9: 67,925,857 S1614I probably benign Het
Vrk2 C T 11: 26,486,959 probably null Het
Xrn1 A G 9: 95,991,056 Y655C probably damaging Het
Other mutations in Nat8f5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Nat8f5 APN 6 85817297 missense probably damaging 1.00
IGL01348:Nat8f5 APN 6 85817880 missense probably damaging 0.98
IGL01672:Nat8f5 APN 6 85817952 missense probably damaging 1.00
IGL01769:Nat8f5 APN 6 85817877 missense probably benign 0.01
IGL02009:Nat8f5 APN 6 85817426 missense probably benign 0.01
IGL02493:Nat8f5 APN 6 85817562 missense probably benign 0.01
IGL03346:Nat8f5 APN 6 85817658 missense probably damaging 1.00
IGL03373:Nat8f5 APN 6 85817547 missense probably benign 0.02
E7848:Nat8f5 UTSW 6 85817619 missense probably damaging 0.99
R0034:Nat8f5 UTSW 6 85817886 missense probably benign 0.05
R1939:Nat8f5 UTSW 6 85817819 missense possibly damaging 0.93
R4514:Nat8f5 UTSW 6 85817423 missense possibly damaging 0.53
R5502:Nat8f5 UTSW 6 85817653 missense probably damaging 1.00
R5770:Nat8f5 UTSW 6 85817675 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATGTCTGTCTGCAAACACTGGG -3'
(R):5'- AGGGCCAAATCACATCTCTGCTG -3'

Sequencing Primer
(F):5'- TGGGCCACATAGTCCTTGAAG -3'
(R):5'- cctgaaagcaacctagaagcc -3'
Posted On2013-07-30