Incidental Mutation 'R0670:Gmfg'
ID61394
Institutional Source Beutler Lab
Gene Symbol Gmfg
Ensembl Gene ENSMUSG00000060791
Gene Nameglia maturation factor, gamma
Synonyms2310057N07Rik, 0610039G16Rik
MMRRC Submission 038855-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R0670 (G1)
Quality Score159
Status Not validated
Chromosome7
Chromosomal Location28437447-28448233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28441528 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 33 (I33K)
Ref Sequence ENSEMBL: ENSMUSP00000103927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040531] [ENSMUST00000078845] [ENSMUST00000108289] [ENSMUST00000108292] [ENSMUST00000135686]
Predicted Effect probably benign
Transcript: ENSMUST00000040531
SMART Domains Protein: ENSMUSP00000040486
Gene: ENSMUSG00000109336

DomainStartEndE-ValueType
low complexity region 81 90 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 278 290 N/A INTRINSIC
SAM 296 359 1.02e-9 SMART
low complexity region 406 420 N/A INTRINSIC
low complexity region 433 461 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000078845
AA Change: I33K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077889
Gene: ENSMUSG00000060791
AA Change: I33K

DomainStartEndE-ValueType
ADF 12 139 2.54e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108289
SMART Domains Protein: ENSMUSP00000103924
Gene: ENSMUSG00000060791

DomainStartEndE-ValueType
ADF 2 98 1.56e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108292
AA Change: I33K

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103927
Gene: ENSMUSG00000060791
AA Change: I33K

DomainStartEndE-ValueType
ADF 12 139 2.54e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135686
SMART Domains Protein: ENSMUSP00000119321
Gene: ENSMUSG00000060791

DomainStartEndE-ValueType
Pfam:Cofilin_ADF 1 87 2.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138741
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A T 2: 155,045,758 D46V probably damaging Het
Abraxas2 A T 7: 132,869,031 probably null Het
Afap1l2 G A 19: 56,915,803 T684I probably damaging Het
Ahcyl1 A T 3: 107,671,165 V205E probably damaging Het
Ap4e1 T A 2: 127,011,864 probably null Het
Brms1 C A 19: 5,045,971 N24K probably damaging Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Col25a1 A G 3: 130,386,895 K130E possibly damaging Het
Crisp1 A C 17: 40,305,110 Y125* probably null Het
Dnhd1 A T 7: 105,696,464 D2272V possibly damaging Het
Elmod1 A G 9: 53,912,822 V294A probably damaging Het
Gm8909 G C 17: 36,168,098 F86L possibly damaging Het
Gsk3b G T 16: 38,144,316 D49Y probably damaging Het
Harbi1 C T 2: 91,712,535 R114W probably damaging Het
Hspbp1 A G 7: 4,677,736 V247A probably damaging Het
Kif17 A T 4: 138,262,499 probably benign Het
Klhl6 T A 16: 19,949,559 H412L possibly damaging Het
Muc1 A G 3: 89,230,532 D227G probably benign Het
Nat8f5 A T 6: 85,817,975 M1K probably null Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nfrkb A T 9: 31,420,173 Q1295L probably benign Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Pcdhb2 A T 18: 37,296,648 D558V probably damaging Het
Pdilt T C 7: 119,500,428 K206E probably benign Het
Pkn2 A T 3: 142,839,343 I23K probably damaging Het
Plec A T 15: 76,205,960 L60Q probably damaging Het
Ranbp2 C A 10: 58,480,698 D2413E probably benign Het
Socs1 A G 16: 10,784,262 Y204H probably damaging Het
Stk39 T C 2: 68,366,182 D301G possibly damaging Het
Tlr5 T A 1: 182,973,889 W253R probably damaging Het
Treml2 A G 17: 48,307,836 probably null Het
Ttn A G 2: 76,749,104 L22069P probably damaging Het
Vps13c G T 9: 67,925,857 S1614I probably benign Het
Vrk2 C T 11: 26,486,959 probably null Het
Xrn1 A G 9: 95,991,056 Y655C probably damaging Het
Other mutations in Gmfg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Gmfg APN 7 28446385 missense possibly damaging 0.76
IGL01581:Gmfg APN 7 28443221 missense probably benign 0.03
IGL02691:Gmfg APN 7 28444870 missense probably damaging 0.98
R3607:Gmfg UTSW 7 28441536 splice site probably null
R4332:Gmfg UTSW 7 28437572 start codon destroyed probably benign 0.00
R4583:Gmfg UTSW 7 28445944 missense probably damaging 1.00
R5348:Gmfg UTSW 7 28446394 missense probably benign 0.18
X0021:Gmfg UTSW 7 28445940 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTGTTTGCCAAAGGCCACTCATC -3'
(R):5'- TTGGAATGTCCAGAATCCCAGCCC -3'

Sequencing Primer
(F):5'- GCGTCTTCATTGACTTACGAAGATAC -3'
(R):5'- AGATTACAGACCCCTCGCCA -3'
Posted On2013-07-30