Incidental Mutation 'R0670:Abraxas2'
ID61397
Institutional Source Beutler Lab
Gene Symbol Abraxas2
Ensembl Gene ENSMUSG00000030965
Gene NameBRISC complex subunit
SynonymsC430003P19Rik, Fam175b, KIAA0157
MMRRC Submission 038855-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock #R0670 (G1)
Quality Score113
Status Not validated
Chromosome7
Chromosomal Location132859225-132885111 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 132869031 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084497] [ENSMUST00000106161] [ENSMUST00000124096] [ENSMUST00000134784]
Predicted Effect probably null
Transcript: ENSMUST00000084497
SMART Domains Protein: ENSMUSP00000081541
Gene: ENSMUSG00000030965

DomainStartEndE-ValueType
coiled coil region 224 276 N/A INTRINSIC
low complexity region 372 385 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106161
SMART Domains Protein: ENSMUSP00000101767
Gene: ENSMUSG00000030965

DomainStartEndE-ValueType
coiled coil region 221 271 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129552
Predicted Effect probably benign
Transcript: ENSMUST00000134784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144225
Predicted Effect probably benign
Transcript: ENSMUST00000147786
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A T 2: 155,045,758 D46V probably damaging Het
Afap1l2 G A 19: 56,915,803 T684I probably damaging Het
Ahcyl1 A T 3: 107,671,165 V205E probably damaging Het
Ap4e1 T A 2: 127,011,864 probably null Het
Brms1 C A 19: 5,045,971 N24K probably damaging Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Col25a1 A G 3: 130,386,895 K130E possibly damaging Het
Crisp1 A C 17: 40,305,110 Y125* probably null Het
Dnhd1 A T 7: 105,696,464 D2272V possibly damaging Het
Elmod1 A G 9: 53,912,822 V294A probably damaging Het
Gm8909 G C 17: 36,168,098 F86L possibly damaging Het
Gmfg T A 7: 28,441,528 I33K probably damaging Het
Gsk3b G T 16: 38,144,316 D49Y probably damaging Het
Harbi1 C T 2: 91,712,535 R114W probably damaging Het
Hspbp1 A G 7: 4,677,736 V247A probably damaging Het
Kif17 A T 4: 138,262,499 probably benign Het
Klhl6 T A 16: 19,949,559 H412L possibly damaging Het
Muc1 A G 3: 89,230,532 D227G probably benign Het
Nat8f5 A T 6: 85,817,975 M1K probably null Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nfrkb A T 9: 31,420,173 Q1295L probably benign Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Pcdhb2 A T 18: 37,296,648 D558V probably damaging Het
Pdilt T C 7: 119,500,428 K206E probably benign Het
Pkn2 A T 3: 142,839,343 I23K probably damaging Het
Plec A T 15: 76,205,960 L60Q probably damaging Het
Ranbp2 C A 10: 58,480,698 D2413E probably benign Het
Socs1 A G 16: 10,784,262 Y204H probably damaging Het
Stk39 T C 2: 68,366,182 D301G possibly damaging Het
Tlr5 T A 1: 182,973,889 W253R probably damaging Het
Treml2 A G 17: 48,307,836 probably null Het
Ttn A G 2: 76,749,104 L22069P probably damaging Het
Vps13c G T 9: 67,925,857 S1614I probably benign Het
Vrk2 C T 11: 26,486,959 probably null Het
Xrn1 A G 9: 95,991,056 Y655C probably damaging Het
Other mutations in Abraxas2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Abraxas2 APN 7 132883428 missense probably benign 0.00
R0123:Abraxas2 UTSW 7 132874855 missense probably damaging 1.00
R0225:Abraxas2 UTSW 7 132874855 missense probably damaging 1.00
R2145:Abraxas2 UTSW 7 132883061 missense probably benign 0.27
R2244:Abraxas2 UTSW 7 132883211 missense probably benign 0.00
R3839:Abraxas2 UTSW 7 132883138 missense probably benign 0.03
R5133:Abraxas2 UTSW 7 132883146 missense probably benign 0.01
R5260:Abraxas2 UTSW 7 132859274 missense probably damaging 1.00
R6217:Abraxas2 UTSW 7 132874965 missense probably damaging 1.00
R6305:Abraxas2 UTSW 7 132874965 missense probably damaging 1.00
R6312:Abraxas2 UTSW 7 132874965 missense probably damaging 1.00
R6313:Abraxas2 UTSW 7 132874965 missense probably damaging 1.00
R6793:Abraxas2 UTSW 7 132874834 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTACGAGAACAACATGGGCTTGG -3'
(R):5'- GCACAGCTCCTCAGATACAGCATTC -3'

Sequencing Primer
(F):5'- ggttgaagagatggctcagtg -3'
(R):5'- CTAAGCATGGTAGCACACTTG -3'
Posted On2013-07-30