Incidental Mutation 'R0673:Yme1l1'
ID61499
Institutional Source Beutler Lab
Gene Symbol Yme1l1
Ensembl Gene ENSMUSG00000026775
Gene NameYME1-like 1 (S. cerevisiae)
SynonymsATP-dependent metalloprotease FtsH1, Ftsh
MMRRC Submission 038858-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R0673 (G1)
Quality Score101
Status Not validated
Chromosome2
Chromosomal Location23156369-23199260 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23168288 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 144 (F144S)
Ref Sequence ENSEMBL: ENSMUSP00000028117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028117]
Predicted Effect probably benign
Transcript: ENSMUST00000028117
AA Change: F144S

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000028117
Gene: ENSMUSG00000026775
AA Change: F144S

DomainStartEndE-ValueType
AAA 313 450 4.77e-23 SMART
Pfam:Peptidase_M41 508 706 5.8e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125004
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148616
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the human ortholog of yeast mitochondrial AAA metalloprotease, Yme1p. It is localized in the mitochondria and can functionally complement a yme1 disruptant yeast strain. It is proposed that this gene plays a role in mitochondrial protein metabolism and could be involved in mitochondrial pathologies. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null embryos die prior to E13.5, and show a developmental delay from E8.5 to E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik C T 17: 45,733,073 W86* probably null Het
2700049A03Rik C T 12: 71,177,868 P894S probably damaging Het
Adgrg7 A T 16: 56,773,486 N122K possibly damaging Het
Ankrd13d A T 19: 4,273,019 probably null Het
Blm A T 7: 80,499,751 probably null Het
Caml C T 13: 55,631,828 T238M probably damaging Het
Casd1 T A 6: 4,624,440 V411D possibly damaging Het
Cdc25b A G 2: 131,197,262 N516D probably benign Het
Cmya5 A G 13: 93,089,997 I2861T probably damaging Het
Csmd3 A G 15: 47,913,940 L1294P probably damaging Het
Cxxc1 A G 18: 74,218,913 D287G possibly damaging Het
Dgkq T C 5: 108,655,589 H217R probably damaging Het
Disp2 A T 2: 118,790,844 I686F possibly damaging Het
Dnah6 T A 6: 73,123,811 N2003I probably benign Het
Dsc3 T A 18: 19,989,590 R92S probably damaging Het
Ei24 T G 9: 36,788,255 probably null Het
Fgl1 G T 8: 41,191,624 T281K probably benign Het
Gbp3 A G 3: 142,565,254 T140A probably benign Het
Gtpbp3 A T 8: 71,492,735 I485F probably damaging Het
Harbi1 C T 2: 91,712,535 R114W probably damaging Het
Inmt A C 6: 55,171,227 V139G probably damaging Het
Inpp5j T A 11: 3,501,147 M501L probably benign Het
Jmjd1c A G 10: 67,226,809 N1647S probably damaging Het
Lgals9 A G 11: 78,965,853 F252L probably damaging Het
Lingo3 C A 10: 80,835,784 R104L probably benign Het
Lrrc8c G A 5: 105,607,678 V440M probably damaging Het
Mybpc3 G A 2: 91,120,427 G36D probably damaging Het
Ncapd3 T A 9: 27,087,477 N1254K probably benign Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nudt12 A T 17: 59,007,622 probably null Het
Olfr140 A C 2: 90,052,252 M24R probably benign Het
Olfr167 A G 16: 19,515,396 M80T probably damaging Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Prr14l C T 5: 32,828,915 D1079N probably benign Het
Rasal1 A G 5: 120,670,384 T494A probably benign Het
Sacs A G 14: 61,210,215 K3237E possibly damaging Het
Sh3d19 T C 3: 86,106,973 S415P probably benign Het
Sypl A T 12: 32,965,421 T40S probably damaging Het
Tg A T 15: 66,741,484 probably null Het
Tmed8 A G 12: 87,174,104 V236A probably damaging Het
Vmn1r33 T C 6: 66,611,799 Y257C probably damaging Het
Other mutations in Yme1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Yme1l1 APN 2 23192500 missense probably benign 0.00
IGL01764:Yme1l1 APN 2 23162544 missense probably benign 0.00
IGL03289:Yme1l1 APN 2 23160268 missense probably benign
R0043:Yme1l1 UTSW 2 23187803 missense probably damaging 0.97
R0540:Yme1l1 UTSW 2 23192515 missense possibly damaging 0.68
R0583:Yme1l1 UTSW 2 23186250 missense probably damaging 1.00
R0661:Yme1l1 UTSW 2 23191042 missense probably damaging 0.96
R2154:Yme1l1 UTSW 2 23162508 missense probably damaging 0.99
R2241:Yme1l1 UTSW 2 23196900 nonsense probably null
R2270:Yme1l1 UTSW 2 23175220 missense possibly damaging 0.53
R2345:Yme1l1 UTSW 2 23194786 missense probably damaging 1.00
R3837:Yme1l1 UTSW 2 23191080 missense possibly damaging 0.69
R4344:Yme1l1 UTSW 2 23173061 missense probably benign 0.02
R4368:Yme1l1 UTSW 2 23160211 missense possibly damaging 0.81
R4412:Yme1l1 UTSW 2 23175187 missense probably damaging 1.00
R4470:Yme1l1 UTSW 2 23186332 critical splice donor site probably null
R4472:Yme1l1 UTSW 2 23186332 critical splice donor site probably null
R4934:Yme1l1 UTSW 2 23168321 nonsense probably null
R5033:Yme1l1 UTSW 2 23194747 missense probably damaging 1.00
R5388:Yme1l1 UTSW 2 23162557 missense probably benign 0.01
R5389:Yme1l1 UTSW 2 23193234 missense probably damaging 1.00
R5943:Yme1l1 UTSW 2 23168330 missense probably damaging 0.96
R5947:Yme1l1 UTSW 2 23195306 intron probably benign
R6243:Yme1l1 UTSW 2 23193172 missense probably benign 0.00
R6724:Yme1l1 UTSW 2 23194762 missense probably damaging 1.00
R6891:Yme1l1 UTSW 2 23195389 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGAACTCCAGCGTAGCAAGTAAG -3'
(R):5'- AAACAGGGTGAGGGCTCCATCAAC -3'

Sequencing Primer
(F):5'- TGTAAAGCATATGGAAATGTCAACAG -3'
(R):5'- GGGCTCCATCAACCAGAAAATG -3'
Posted On2013-07-30