Incidental Mutation 'R0673:Disp2'
ID61505
Institutional Source Beutler Lab
Gene Symbol Disp2
Ensembl Gene ENSMUSG00000040035
Gene Namedispatched RND tramsporter family member 2
SynonymsB230210L08Rik, DispB
MMRRC Submission 038858-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.571) question?
Stock #R0673 (G1)
Quality Score112
Status Not validated
Chromosome2
Chromosomal Location118779719-118811293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118790844 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 686 (I686F)
Ref Sequence ENSEMBL: ENSMUSP00000037136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037547] [ENSMUST00000063975] [ENSMUST00000110843] [ENSMUST00000110846]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037547
AA Change: I686F

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000037136
Gene: ENSMUSG00000040035
AA Change: I686F

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Pfam:MMPL 435 635 9.7e-8 PFAM
Pfam:Sterol-sensing 458 611 9.1e-9 PFAM
transmembrane domain 657 679 N/A INTRINSIC
low complexity region 682 695 N/A INTRINSIC
low complexity region 748 761 N/A INTRINSIC
transmembrane domain 914 936 N/A INTRINSIC
transmembrane domain 943 965 N/A INTRINSIC
transmembrane domain 975 997 N/A INTRINSIC
transmembrane domain 1018 1040 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063975
SMART Domains Protein: ENSMUSP00000070031
Gene: ENSMUSG00000040035

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110843
SMART Domains Protein: ENSMUSP00000106467
Gene: ENSMUSG00000040035

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110846
SMART Domains Protein: ENSMUSP00000106470
Gene: ENSMUSG00000040035

DomainStartEndE-ValueType
transmembrane domain 123 145 N/A INTRINSIC
low complexity region 195 203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142072
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik C T 17: 45,733,073 W86* probably null Het
2700049A03Rik C T 12: 71,177,868 P894S probably damaging Het
Adgrg7 A T 16: 56,773,486 N122K possibly damaging Het
Ankrd13d A T 19: 4,273,019 probably null Het
Blm A T 7: 80,499,751 probably null Het
Caml C T 13: 55,631,828 T238M probably damaging Het
Casd1 T A 6: 4,624,440 V411D possibly damaging Het
Cdc25b A G 2: 131,197,262 N516D probably benign Het
Cmya5 A G 13: 93,089,997 I2861T probably damaging Het
Csmd3 A G 15: 47,913,940 L1294P probably damaging Het
Cxxc1 A G 18: 74,218,913 D287G possibly damaging Het
Dgkq T C 5: 108,655,589 H217R probably damaging Het
Dnah6 T A 6: 73,123,811 N2003I probably benign Het
Dsc3 T A 18: 19,989,590 R92S probably damaging Het
Ei24 T G 9: 36,788,255 probably null Het
Fgl1 G T 8: 41,191,624 T281K probably benign Het
Gbp3 A G 3: 142,565,254 T140A probably benign Het
Gtpbp3 A T 8: 71,492,735 I485F probably damaging Het
Harbi1 C T 2: 91,712,535 R114W probably damaging Het
Inmt A C 6: 55,171,227 V139G probably damaging Het
Inpp5j T A 11: 3,501,147 M501L probably benign Het
Jmjd1c A G 10: 67,226,809 N1647S probably damaging Het
Lgals9 A G 11: 78,965,853 F252L probably damaging Het
Lingo3 C A 10: 80,835,784 R104L probably benign Het
Lrrc8c G A 5: 105,607,678 V440M probably damaging Het
Mybpc3 G A 2: 91,120,427 G36D probably damaging Het
Ncapd3 T A 9: 27,087,477 N1254K probably benign Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nudt12 A T 17: 59,007,622 probably null Het
Olfr140 A C 2: 90,052,252 M24R probably benign Het
Olfr167 A G 16: 19,515,396 M80T probably damaging Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Prr14l C T 5: 32,828,915 D1079N probably benign Het
Rasal1 A G 5: 120,670,384 T494A probably benign Het
Sacs A G 14: 61,210,215 K3237E possibly damaging Het
Sh3d19 T C 3: 86,106,973 S415P probably benign Het
Sypl A T 12: 32,965,421 T40S probably damaging Het
Tg A T 15: 66,741,484 probably null Het
Tmed8 A G 12: 87,174,104 V236A probably damaging Het
Vmn1r33 T C 6: 66,611,799 Y257C probably damaging Het
Yme1l1 T C 2: 23,168,288 F144S probably benign Het
Other mutations in Disp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Disp2 APN 2 118786278 missense probably damaging 1.00
IGL00970:Disp2 APN 2 118791793 missense probably damaging 1.00
IGL01790:Disp2 APN 2 118790880 missense probably damaging 1.00
IGL01809:Disp2 APN 2 118787264 splice site probably benign
IGL02069:Disp2 APN 2 118790680 missense possibly damaging 0.93
IGL02140:Disp2 APN 2 118790869 missense probably benign
IGL02143:Disp2 APN 2 118789969 missense probably damaging 1.00
IGL02155:Disp2 APN 2 118791804 missense probably damaging 1.00
IGL02884:Disp2 APN 2 118787551 splice site probably benign
IGL03113:Disp2 APN 2 118790778 unclassified probably null
IGL03194:Disp2 APN 2 118787629 missense probably damaging 1.00
PIT4453001:Disp2 UTSW 2 118787644 missense probably benign 0.01
R0109:Disp2 UTSW 2 118791816 missense probably damaging 1.00
R0126:Disp2 UTSW 2 118790338 missense probably damaging 1.00
R0603:Disp2 UTSW 2 118792006 missense probably damaging 1.00
R0610:Disp2 UTSW 2 118792236 missense probably benign 0.02
R0639:Disp2 UTSW 2 118790844 missense possibly damaging 0.74
R0755:Disp2 UTSW 2 118789762 missense probably benign 0.00
R0781:Disp2 UTSW 2 118790439 missense probably damaging 1.00
R1110:Disp2 UTSW 2 118790439 missense probably damaging 1.00
R1148:Disp2 UTSW 2 118806418 critical splice donor site probably null
R1148:Disp2 UTSW 2 118806418 critical splice donor site probably null
R1243:Disp2 UTSW 2 118791822 missense probably damaging 1.00
R1587:Disp2 UTSW 2 118791583 missense probably damaging 1.00
R1739:Disp2 UTSW 2 118791550 missense probably damaging 1.00
R1771:Disp2 UTSW 2 118791297 nonsense probably null
R1781:Disp2 UTSW 2 118792561 missense probably damaging 0.96
R1918:Disp2 UTSW 2 118791927 missense probably benign
R1956:Disp2 UTSW 2 118792223 missense probably benign 0.02
R2167:Disp2 UTSW 2 118791685 missense probably damaging 1.00
R2206:Disp2 UTSW 2 118792244 missense probably benign 0.02
R4031:Disp2 UTSW 2 118791880 missense probably benign 0.27
R4617:Disp2 UTSW 2 118790162 missense probably benign
R4656:Disp2 UTSW 2 118790563 missense probably damaging 1.00
R4684:Disp2 UTSW 2 118792756 missense probably damaging 1.00
R4696:Disp2 UTSW 2 118791684 nonsense probably null
R4697:Disp2 UTSW 2 118791684 nonsense probably null
R4738:Disp2 UTSW 2 118790326 missense probably damaging 0.97
R4834:Disp2 UTSW 2 118792504 missense probably benign 0.09
R4914:Disp2 UTSW 2 118790454 missense probably damaging 0.99
R4915:Disp2 UTSW 2 118790454 missense probably damaging 0.99
R4918:Disp2 UTSW 2 118790454 missense probably damaging 0.99
R5045:Disp2 UTSW 2 118792062 missense probably benign 0.03
R5208:Disp2 UTSW 2 118791805 missense probably damaging 1.00
R5303:Disp2 UTSW 2 118810848 unclassified probably benign
R5350:Disp2 UTSW 2 118787575 missense probably benign 0.23
R5355:Disp2 UTSW 2 118786911 missense probably benign 0.00
R6011:Disp2 UTSW 2 118790820 missense possibly damaging 0.65
R6031:Disp2 UTSW 2 118789794 missense probably benign 0.01
R6031:Disp2 UTSW 2 118789794 missense probably benign 0.01
R6139:Disp2 UTSW 2 118790662 missense probably damaging 0.97
R6169:Disp2 UTSW 2 118791550 missense probably damaging 1.00
R6187:Disp2 UTSW 2 118792143 missense probably damaging 1.00
R6209:Disp2 UTSW 2 118786921 missense probably damaging 1.00
R6250:Disp2 UTSW 2 118790766 missense probably damaging 1.00
R6392:Disp2 UTSW 2 118790749 missense probably damaging 1.00
R7138:Disp2 UTSW 2 118786880 missense probably benign
R7156:Disp2 UTSW 2 118791811 missense probably damaging 1.00
R7230:Disp2 UTSW 2 118791805 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCATGCACCACTTTGGCTACC -3'
(R):5'- GCGAGAAGTCAGGATCACTTACCAC -3'

Sequencing Primer
(F):5'- TTCTACGGCAGCTACCTGAG -3'
(R):5'- GGATCACTTACCACTGAGCTG -3'
Posted On2013-07-30