Incidental Mutation 'R0673:Cdc25b'
ID61506
Institutional Source Beutler Lab
Gene Symbol Cdc25b
Ensembl Gene ENSMUSG00000027330
Gene Namecell division cycle 25B
Synonyms
MMRRC Submission 038858-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0673 (G1)
Quality Score93
Status Not validated
Chromosome2
Chromosomal Location131186949-131198497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 131197262 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 516 (N516D)
Ref Sequence ENSEMBL: ENSMUSP00000078784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028804] [ENSMUST00000079857]
Predicted Effect probably benign
Transcript: ENSMUST00000028804
AA Change: N542D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028804
Gene: ENSMUSG00000027330
AA Change: N542D

DomainStartEndE-ValueType
low complexity region 86 105 N/A INTRINSIC
Pfam:M-inducer_phosp 111 379 3.3e-103 PFAM
RHOD 417 531 4.29e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079857
AA Change: N516D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000078784
Gene: ENSMUSG00000027330
AA Change: N516D

DomainStartEndE-ValueType
low complexity region 86 105 N/A INTRINSIC
Pfam:M-inducer_phosp 111 354 2.4e-78 PFAM
RHOD 391 505 4.29e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141732
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145556
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CDC25B is a member of the CDC25 family of phosphatases. CDC25B activates the cyclin dependent kinase CDC2 by removing two phosphate groups and it is required for entry into mitosis. CDC25B shuttles between the nucleus and the cytoplasm due to nuclear localization and nuclear export signals. The protein is nuclear in the M and G1 phases of the cell cycle and moves to the cytoplasm during S and G2. CDC25B has oncogenic properties, although its role in tumor formation has not been determined. Multiple transcript variants for this gene exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: The resumption of meiosis during oocyte maturation is blocked in homozygous mutant female mice, resulting in female infertility. Male mice do not show an overt reproductive phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik C T 17: 45,733,073 W86* probably null Het
2700049A03Rik C T 12: 71,177,868 P894S probably damaging Het
Adgrg7 A T 16: 56,773,486 N122K possibly damaging Het
Ankrd13d A T 19: 4,273,019 probably null Het
Blm A T 7: 80,499,751 probably null Het
Caml C T 13: 55,631,828 T238M probably damaging Het
Casd1 T A 6: 4,624,440 V411D possibly damaging Het
Cmya5 A G 13: 93,089,997 I2861T probably damaging Het
Csmd3 A G 15: 47,913,940 L1294P probably damaging Het
Cxxc1 A G 18: 74,218,913 D287G possibly damaging Het
Dgkq T C 5: 108,655,589 H217R probably damaging Het
Disp2 A T 2: 118,790,844 I686F possibly damaging Het
Dnah6 T A 6: 73,123,811 N2003I probably benign Het
Dsc3 T A 18: 19,989,590 R92S probably damaging Het
Ei24 T G 9: 36,788,255 probably null Het
Fgl1 G T 8: 41,191,624 T281K probably benign Het
Gbp3 A G 3: 142,565,254 T140A probably benign Het
Gtpbp3 A T 8: 71,492,735 I485F probably damaging Het
Harbi1 C T 2: 91,712,535 R114W probably damaging Het
Inmt A C 6: 55,171,227 V139G probably damaging Het
Inpp5j T A 11: 3,501,147 M501L probably benign Het
Jmjd1c A G 10: 67,226,809 N1647S probably damaging Het
Lgals9 A G 11: 78,965,853 F252L probably damaging Het
Lingo3 C A 10: 80,835,784 R104L probably benign Het
Lrrc8c G A 5: 105,607,678 V440M probably damaging Het
Mybpc3 G A 2: 91,120,427 G36D probably damaging Het
Ncapd3 T A 9: 27,087,477 N1254K probably benign Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nudt12 A T 17: 59,007,622 probably null Het
Olfr140 A C 2: 90,052,252 M24R probably benign Het
Olfr167 A G 16: 19,515,396 M80T probably damaging Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Prr14l C T 5: 32,828,915 D1079N probably benign Het
Rasal1 A G 5: 120,670,384 T494A probably benign Het
Sacs A G 14: 61,210,215 K3237E possibly damaging Het
Sh3d19 T C 3: 86,106,973 S415P probably benign Het
Sypl A T 12: 32,965,421 T40S probably damaging Het
Tg A T 15: 66,741,484 probably null Het
Tmed8 A G 12: 87,174,104 V236A probably damaging Het
Vmn1r33 T C 6: 66,611,799 Y257C probably damaging Het
Yme1l1 T C 2: 23,168,288 F144S probably benign Het
Other mutations in Cdc25b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03230:Cdc25b APN 2 131188140 missense probably benign 0.00
R0471:Cdc25b UTSW 2 131197284 missense probably damaging 0.99
R0639:Cdc25b UTSW 2 131197262 missense probably benign 0.00
R0645:Cdc25b UTSW 2 131191613 missense probably benign 0.06
R1574:Cdc25b UTSW 2 131191137 splice site probably benign
R4094:Cdc25b UTSW 2 131189117 missense probably benign
R4433:Cdc25b UTSW 2 131191698 missense probably benign 0.02
R4722:Cdc25b UTSW 2 131193351 missense probably damaging 1.00
R4817:Cdc25b UTSW 2 131193303 missense probably damaging 1.00
R4957:Cdc25b UTSW 2 131193605 missense possibly damaging 0.80
R5345:Cdc25b UTSW 2 131192596 missense probably benign 0.18
R5407:Cdc25b UTSW 2 131193647 missense probably damaging 1.00
R5562:Cdc25b UTSW 2 131194758 missense probably damaging 1.00
R5594:Cdc25b UTSW 2 131191618 missense probably damaging 1.00
R5792:Cdc25b UTSW 2 131191759 missense probably damaging 1.00
R5831:Cdc25b UTSW 2 131187381 critical splice donor site probably null
R7204:Cdc25b UTSW 2 131191632 missense probably damaging 1.00
R7292:Cdc25b UTSW 2 131191173 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCCCACAGCATCCGGTACTATG -3'
(R):5'- CACCCTCAGGTTCAGCTCTTTAAGC -3'

Sequencing Primer
(F):5'- GCATCCGGTACTATGGGTGG -3'
(R):5'- CTTTAAGCTGGGACCAGTACC -3'
Posted On2013-07-30