Incidental Mutation 'R0673:Lgals9'
ID61530
Institutional Source Beutler Lab
Gene Symbol Lgals9
Ensembl Gene ENSMUSG00000001123
Gene Namelectin, galactose binding, soluble 9
SynonymsLgals5, galectin-9, LGALS35, gal-9
MMRRC Submission 038858-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R0673 (G1)
Quality Score202
Status Not validated
Chromosome11
Chromosomal Location78962974-78984946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78965853 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 252 (F252L)
Ref Sequence ENSEMBL: ENSMUSP00000103904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073001] [ENSMUST00000108268] [ENSMUST00000108269]
Predicted Effect probably damaging
Transcript: ENSMUST00000073001
AA Change: F251L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072764
Gene: ENSMUSG00000001123
AA Change: F251L

DomainStartEndE-ValueType
GLECT 15 147 6.58e-55 SMART
Gal-bind_lectin 21 146 5.24e-55 SMART
GLECT 222 352 5.38e-60 SMART
Gal-bind_lectin 228 352 1.33e-65 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108268
AA Change: F221L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103903
Gene: ENSMUSG00000001123
AA Change: F221L

DomainStartEndE-ValueType
GLECT 15 147 6.58e-55 SMART
Gal-bind_lectin 21 146 5.24e-55 SMART
GLECT 192 322 5.38e-60 SMART
Gal-bind_lectin 198 322 1.33e-65 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108269
AA Change: F252L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103904
Gene: ENSMUSG00000001123
AA Change: F252L

DomainStartEndE-ValueType
GLECT 15 147 6.58e-55 SMART
Gal-bind_lectin 21 146 5.24e-55 SMART
GLECT 223 353 5.38e-60 SMART
Gal-bind_lectin 229 353 1.33e-65 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140073
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was initially thought to represent a pseudogene of galectin 9; however, this transcript has good exon-intron structure and encodes a predicted protein of the same size as and highly similar to galectin 9. This gene is one of two similar loci on chromosome 17p similar to galectin 9 and now thought to be protein-encoding. This gene is the more centromeric gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased susceptibility to collagen-induced arthritis, increased T-helper 1 cells and decreased regulatory T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik C T 17: 45,733,073 W86* probably null Het
2700049A03Rik C T 12: 71,177,868 P894S probably damaging Het
Adgrg7 A T 16: 56,773,486 N122K possibly damaging Het
Ankrd13d A T 19: 4,273,019 probably null Het
Blm A T 7: 80,499,751 probably null Het
Caml C T 13: 55,631,828 T238M probably damaging Het
Casd1 T A 6: 4,624,440 V411D possibly damaging Het
Cdc25b A G 2: 131,197,262 N516D probably benign Het
Cmya5 A G 13: 93,089,997 I2861T probably damaging Het
Csmd3 A G 15: 47,913,940 L1294P probably damaging Het
Cxxc1 A G 18: 74,218,913 D287G possibly damaging Het
Dgkq T C 5: 108,655,589 H217R probably damaging Het
Disp2 A T 2: 118,790,844 I686F possibly damaging Het
Dnah6 T A 6: 73,123,811 N2003I probably benign Het
Dsc3 T A 18: 19,989,590 R92S probably damaging Het
Ei24 T G 9: 36,788,255 probably null Het
Fgl1 G T 8: 41,191,624 T281K probably benign Het
Gbp3 A G 3: 142,565,254 T140A probably benign Het
Gtpbp3 A T 8: 71,492,735 I485F probably damaging Het
Harbi1 C T 2: 91,712,535 R114W probably damaging Het
Inmt A C 6: 55,171,227 V139G probably damaging Het
Inpp5j T A 11: 3,501,147 M501L probably benign Het
Jmjd1c A G 10: 67,226,809 N1647S probably damaging Het
Lingo3 C A 10: 80,835,784 R104L probably benign Het
Lrrc8c G A 5: 105,607,678 V440M probably damaging Het
Mybpc3 G A 2: 91,120,427 G36D probably damaging Het
Ncapd3 T A 9: 27,087,477 N1254K probably benign Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nudt12 A T 17: 59,007,622 probably null Het
Olfr140 A C 2: 90,052,252 M24R probably benign Het
Olfr167 A G 16: 19,515,396 M80T probably damaging Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Prr14l C T 5: 32,828,915 D1079N probably benign Het
Rasal1 A G 5: 120,670,384 T494A probably benign Het
Sacs A G 14: 61,210,215 K3237E possibly damaging Het
Sh3d19 T C 3: 86,106,973 S415P probably benign Het
Sypl A T 12: 32,965,421 T40S probably damaging Het
Tg A T 15: 66,741,484 probably null Het
Tmed8 A G 12: 87,174,104 V236A probably damaging Het
Vmn1r33 T C 6: 66,611,799 Y257C probably damaging Het
Yme1l1 T C 2: 23,168,288 F144S probably benign Het
Other mutations in Lgals9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Lgals9 APN 11 78973151 missense probably damaging 1.00
IGL01415:Lgals9 APN 11 78973151 missense probably damaging 1.00
IGL02194:Lgals9 APN 11 78966920 critical splice acceptor site probably null
IGL02390:Lgals9 APN 11 78963535 missense probably damaging 1.00
IGL02987:Lgals9 APN 11 78967477 missense possibly damaging 0.93
IGL03288:Lgals9 APN 11 78984800 missense probably benign 0.01
IGL03388:Lgals9 APN 11 78963421 missense probably damaging 0.99
R0057:Lgals9 UTSW 11 78971436 splice site probably benign
R0143:Lgals9 UTSW 11 78963535 missense probably damaging 1.00
R0325:Lgals9 UTSW 11 78963448 missense probably damaging 0.99
R0522:Lgals9 UTSW 11 78965812 missense possibly damaging 0.95
R0542:Lgals9 UTSW 11 78969720 missense possibly damaging 0.68
R1312:Lgals9 UTSW 11 78976617 nonsense probably null
R2000:Lgals9 UTSW 11 78973170 missense probably benign 0.01
R4083:Lgals9 UTSW 11 78969763 missense possibly damaging 0.63
R4084:Lgals9 UTSW 11 78969763 missense possibly damaging 0.63
R4157:Lgals9 UTSW 11 78973107 missense possibly damaging 0.88
R4204:Lgals9 UTSW 11 78969816 splice site probably benign
R4892:Lgals9 UTSW 11 78966083 missense probably benign 0.00
R5650:Lgals9 UTSW 11 78973154 missense probably damaging 0.97
R6155:Lgals9 UTSW 11 78963505 missense probably benign 0.16
R6166:Lgals9 UTSW 11 78971358 missense probably benign 0.14
R6405:Lgals9 UTSW 11 78971385 missense probably benign 0.42
R6853:Lgals9 UTSW 11 78966006 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TTTGGGATGCAGCCCTCACATCAC -3'
(R):5'- GCCAGATGCTACGAGGTAAGACAAC -3'

Sequencing Primer
(F):5'- AGGCATCAGCCTGTATCCC -3'
(R):5'- GAGGTAAGACAACCCCCAGG -3'
Posted On2013-07-30