Incidental Mutation 'R0673:Tmed8'
ID61533
Institutional Source Beutler Lab
Gene Symbol Tmed8
Ensembl Gene ENSMUSG00000034111
Gene Nametransmembrane p24 trafficking protein 8
Synonyms6430595O10Rik, Mem1, LOC382620
MMRRC Submission 038858-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R0673 (G1)
Quality Score123
Status Not validated
Chromosome12
Chromosomal Location87166237-87200454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87174104 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 236 (V236A)
Ref Sequence ENSEMBL: ENSMUSP00000043742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037418]
Predicted Effect probably damaging
Transcript: ENSMUST00000037418
AA Change: V236A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043742
Gene: ENSMUSG00000034111
AA Change: V236A

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
Pfam:GOLD_2 186 325 2.2e-73 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik C T 17: 45,733,073 W86* probably null Het
2700049A03Rik C T 12: 71,177,868 P894S probably damaging Het
Adgrg7 A T 16: 56,773,486 N122K possibly damaging Het
Ankrd13d A T 19: 4,273,019 probably null Het
Blm A T 7: 80,499,751 probably null Het
Caml C T 13: 55,631,828 T238M probably damaging Het
Casd1 T A 6: 4,624,440 V411D possibly damaging Het
Cdc25b A G 2: 131,197,262 N516D probably benign Het
Cmya5 A G 13: 93,089,997 I2861T probably damaging Het
Csmd3 A G 15: 47,913,940 L1294P probably damaging Het
Cxxc1 A G 18: 74,218,913 D287G possibly damaging Het
Dgkq T C 5: 108,655,589 H217R probably damaging Het
Disp2 A T 2: 118,790,844 I686F possibly damaging Het
Dnah6 T A 6: 73,123,811 N2003I probably benign Het
Dsc3 T A 18: 19,989,590 R92S probably damaging Het
Ei24 T G 9: 36,788,255 probably null Het
Fgl1 G T 8: 41,191,624 T281K probably benign Het
Gbp3 A G 3: 142,565,254 T140A probably benign Het
Gtpbp3 A T 8: 71,492,735 I485F probably damaging Het
Harbi1 C T 2: 91,712,535 R114W probably damaging Het
Inmt A C 6: 55,171,227 V139G probably damaging Het
Inpp5j T A 11: 3,501,147 M501L probably benign Het
Jmjd1c A G 10: 67,226,809 N1647S probably damaging Het
Lgals9 A G 11: 78,965,853 F252L probably damaging Het
Lingo3 C A 10: 80,835,784 R104L probably benign Het
Lrrc8c G A 5: 105,607,678 V440M probably damaging Het
Mybpc3 G A 2: 91,120,427 G36D probably damaging Het
Ncapd3 T A 9: 27,087,477 N1254K probably benign Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nudt12 A T 17: 59,007,622 probably null Het
Olfr140 A C 2: 90,052,252 M24R probably benign Het
Olfr167 A G 16: 19,515,396 M80T probably damaging Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Prr14l C T 5: 32,828,915 D1079N probably benign Het
Rasal1 A G 5: 120,670,384 T494A probably benign Het
Sacs A G 14: 61,210,215 K3237E possibly damaging Het
Sh3d19 T C 3: 86,106,973 S415P probably benign Het
Sypl A T 12: 32,965,421 T40S probably damaging Het
Tg A T 15: 66,741,484 probably null Het
Vmn1r33 T C 6: 66,611,799 Y257C probably damaging Het
Yme1l1 T C 2: 23,168,288 F144S probably benign Het
Other mutations in Tmed8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Tmed8 APN 12 87176671 missense probably benign
IGL02302:Tmed8 APN 12 87174216 missense probably damaging 1.00
R2161:Tmed8 UTSW 12 87174257 missense probably damaging 1.00
R4663:Tmed8 UTSW 12 87174231 missense probably damaging 1.00
R5287:Tmed8 UTSW 12 87174183 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTGCAATGCTGCCTTGCATTC -3'
(R):5'- AAACAAGTTGGTGGAGGCCCTTAG -3'

Sequencing Primer
(F):5'- TTCTGAGTGGGCAGAGAATGC -3'
(R):5'- CTGGACCTTTGCCAAAGTG -3'
Posted On2013-07-30