Incidental Mutation 'R0673:Caml'
ID61534
Institutional Source Beutler Lab
Gene Symbol Caml
Ensembl Gene ENSMUSG00000021501
Gene Namecalcium modulating ligand
Synonyms
MMRRC Submission 038858-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0673 (G1)
Quality Score125
Status Not validated
Chromosome13
Chromosomal Location55623005-55632411 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55631828 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 238 (T238M)
Ref Sequence ENSEMBL: ENSMUSP00000021963 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021963] [ENSMUST00000099479] [ENSMUST00000172272] [ENSMUST00000223736]
Predicted Effect probably damaging
Transcript: ENSMUST00000021963
AA Change: T238M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021963
Gene: ENSMUSG00000021501
AA Change: T238M

DomainStartEndE-ValueType
Pfam:CAML 21 290 8.8e-143 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000099479
SMART Domains Protein: ENSMUSP00000097078
Gene: ENSMUSG00000021500

DomainStartEndE-ValueType
low complexity region 9 109 N/A INTRINSIC
Blast:DEXDc 110 348 4e-76 BLAST
DEXDc 391 592 3.27e-49 SMART
HELICc 629 710 1.55e-27 SMART
low complexity region 760 776 N/A INTRINSIC
low complexity region 798 813 N/A INTRINSIC
internal_repeat_1 855 894 6.68e-7 PROSPERO
low complexity region 911 925 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165154
Predicted Effect probably benign
Transcript: ENSMUST00000172272
SMART Domains Protein: ENSMUSP00000133245
Gene: ENSMUSG00000021500

DomainStartEndE-ValueType
low complexity region 9 109 N/A INTRINSIC
Blast:DEXDc 110 348 5e-76 BLAST
DEXDc 391 596 8.03e-67 SMART
HELICc 633 714 1.55e-27 SMART
low complexity region 764 780 N/A INTRINSIC
low complexity region 802 817 N/A INTRINSIC
internal_repeat_1 859 898 1.04e-6 PROSPERO
low complexity region 915 929 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224551
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The immunosuppressant drug cyclosporin A blocks a calcium-dependent signal from the T-cell receptor (TCR) that normally leads to T-cell activation. When bound to cyclophilin B, cyclosporin A binds and inactivates the key signaling intermediate calcineurin. The protein encoded by this gene functions similarly to cyclosporin A, binding to cyclophilin B and acting downstream of the TCR and upstream of calcineurin by causing an influx of calcium. This integral membrane protein appears to be a new participant in the calcium signal transduction pathway, implicating cyclophilin B in calcium signaling, even in the absence of cyclosporin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice lacking both functional copies of this gene die during early gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik C T 17: 45,733,073 W86* probably null Het
2700049A03Rik C T 12: 71,177,868 P894S probably damaging Het
Adgrg7 A T 16: 56,773,486 N122K possibly damaging Het
Ankrd13d A T 19: 4,273,019 probably null Het
Blm A T 7: 80,499,751 probably null Het
Casd1 T A 6: 4,624,440 V411D possibly damaging Het
Cdc25b A G 2: 131,197,262 N516D probably benign Het
Cmya5 A G 13: 93,089,997 I2861T probably damaging Het
Csmd3 A G 15: 47,913,940 L1294P probably damaging Het
Cxxc1 A G 18: 74,218,913 D287G possibly damaging Het
Dgkq T C 5: 108,655,589 H217R probably damaging Het
Disp2 A T 2: 118,790,844 I686F possibly damaging Het
Dnah6 T A 6: 73,123,811 N2003I probably benign Het
Dsc3 T A 18: 19,989,590 R92S probably damaging Het
Ei24 T G 9: 36,788,255 probably null Het
Fgl1 G T 8: 41,191,624 T281K probably benign Het
Gbp3 A G 3: 142,565,254 T140A probably benign Het
Gtpbp3 A T 8: 71,492,735 I485F probably damaging Het
Harbi1 C T 2: 91,712,535 R114W probably damaging Het
Inmt A C 6: 55,171,227 V139G probably damaging Het
Inpp5j T A 11: 3,501,147 M501L probably benign Het
Jmjd1c A G 10: 67,226,809 N1647S probably damaging Het
Lgals9 A G 11: 78,965,853 F252L probably damaging Het
Lingo3 C A 10: 80,835,784 R104L probably benign Het
Lrrc8c G A 5: 105,607,678 V440M probably damaging Het
Mybpc3 G A 2: 91,120,427 G36D probably damaging Het
Ncapd3 T A 9: 27,087,477 N1254K probably benign Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nudt12 A T 17: 59,007,622 probably null Het
Olfr140 A C 2: 90,052,252 M24R probably benign Het
Olfr167 A G 16: 19,515,396 M80T probably damaging Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Prr14l C T 5: 32,828,915 D1079N probably benign Het
Rasal1 A G 5: 120,670,384 T494A probably benign Het
Sacs A G 14: 61,210,215 K3237E possibly damaging Het
Sh3d19 T C 3: 86,106,973 S415P probably benign Het
Sypl A T 12: 32,965,421 T40S probably damaging Het
Tg A T 15: 66,741,484 probably null Het
Tmed8 A G 12: 87,174,104 V236A probably damaging Het
Vmn1r33 T C 6: 66,611,799 Y257C probably damaging Het
Yme1l1 T C 2: 23,168,288 F144S probably benign Het
Other mutations in Caml
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02469:Caml APN 13 55628577 missense probably damaging 1.00
IGL02961:Caml APN 13 55631882 missense probably benign 0.08
H8786:Caml UTSW 13 55628596 missense probably damaging 1.00
R0542:Caml UTSW 13 55623161 missense possibly damaging 0.94
R1106:Caml UTSW 13 55624725 missense probably benign 0.01
R1171:Caml UTSW 13 55625007 missense probably damaging 1.00
R1661:Caml UTSW 13 55631971 missense probably benign 0.12
R1665:Caml UTSW 13 55631971 missense probably benign 0.12
R4613:Caml UTSW 13 55625142 missense probably damaging 0.99
R4774:Caml UTSW 13 55631927 missense possibly damaging 0.96
R5945:Caml UTSW 13 55628632 missense probably damaging 1.00
R6247:Caml UTSW 13 55625173 critical splice donor site probably null
R6433:Caml UTSW 13 55623249 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCTCGGATTTACCTATTGTGCCCAG -3'
(R):5'- CAGTCTTTTAGGCAGGCTGAGACC -3'

Sequencing Primer
(F):5'- ACCTATTGTGCCCAGTAAGTG -3'
(R):5'- GACCTGTCTATCTAGTCGCCTAAAAG -3'
Posted On2013-07-30