Incidental Mutation 'R0673:Cxxc1'
ID61546
Institutional Source Beutler Lab
Gene Symbol Cxxc1
Ensembl Gene ENSMUSG00000024560
Gene NameCXXC finger 1 (PHD domain)
Synonyms2410002I16Rik, 5830420C16Rik, PHF18, Cgbp, Cfp1
MMRRC Submission 038858-MU
Accession Numbers

Ncbi RefSeq: NM_028868.3; MGI:1921572

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0673 (G1)
Quality Score84
Status Not validated
Chromosome18
Chromosomal Location74216131-74221491 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74218913 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 287 (D287G)
Ref Sequence ENSEMBL: ENSMUSP00000025444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025444]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025444
AA Change: D287G

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025444
Gene: ENSMUSG00000024560
AA Change: D287G

DomainStartEndE-ValueType
PHD 28 74 1.26e-10 SMART
Pfam:zf-CXXC 164 212 2.4e-19 PFAM
low complexity region 237 253 N/A INTRINSIC
low complexity region 272 282 N/A INTRINSIC
low complexity region 325 364 N/A INTRINSIC
Pfam:zf-CpG_bind_C 404 640 2.1e-108 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype Strain: 2654854
Lethality: E1-E7
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that functions as a transcriptional activator that binds specifically to non-methylated CpG motifs through its CXXC domain. The protein is a component of the SETD1 complex, regulates gene expression and is essential for vertebrate development. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit peri-implantation lethality and failure to gastrulate. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(2) Gene trapped(1)
 

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik C T 17: 45,733,073 W86* probably null Het
2700049A03Rik C T 12: 71,177,868 P894S probably damaging Het
Adgrg7 A T 16: 56,773,486 N122K possibly damaging Het
Ankrd13d A T 19: 4,273,019 probably null Het
Blm A T 7: 80,499,751 probably null Het
Caml C T 13: 55,631,828 T238M probably damaging Het
Casd1 T A 6: 4,624,440 V411D possibly damaging Het
Cdc25b A G 2: 131,197,262 N516D probably benign Het
Cmya5 A G 13: 93,089,997 I2861T probably damaging Het
Csmd3 A G 15: 47,913,940 L1294P probably damaging Het
Dgkq T C 5: 108,655,589 H217R probably damaging Het
Disp2 A T 2: 118,790,844 I686F possibly damaging Het
Dnah6 T A 6: 73,123,811 N2003I probably benign Het
Dsc3 T A 18: 19,989,590 R92S probably damaging Het
Ei24 T G 9: 36,788,255 probably null Het
Fgl1 G T 8: 41,191,624 T281K probably benign Het
Gbp3 A G 3: 142,565,254 T140A probably benign Het
Gtpbp3 A T 8: 71,492,735 I485F probably damaging Het
Harbi1 C T 2: 91,712,535 R114W probably damaging Het
Inmt A C 6: 55,171,227 V139G probably damaging Het
Inpp5j T A 11: 3,501,147 M501L probably benign Het
Jmjd1c A G 10: 67,226,809 N1647S probably damaging Het
Lgals9 A G 11: 78,965,853 F252L probably damaging Het
Lingo3 C A 10: 80,835,784 R104L probably benign Het
Lrrc8c G A 5: 105,607,678 V440M probably damaging Het
Mybpc3 G A 2: 91,120,427 G36D probably damaging Het
Ncapd3 T A 9: 27,087,477 N1254K probably benign Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nudt12 A T 17: 59,007,622 probably null Het
Olfr140 A C 2: 90,052,252 M24R probably benign Het
Olfr167 A G 16: 19,515,396 M80T probably damaging Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Prr14l C T 5: 32,828,915 D1079N probably benign Het
Rasal1 A G 5: 120,670,384 T494A probably benign Het
Sacs A G 14: 61,210,215 K3237E possibly damaging Het
Sh3d19 T C 3: 86,106,973 S415P probably benign Het
Sypl A T 12: 32,965,421 T40S probably damaging Het
Tg A T 15: 66,741,484 probably null Het
Tmed8 A G 12: 87,174,104 V236A probably damaging Het
Vmn1r33 T C 6: 66,611,799 Y257C probably damaging Het
Yme1l1 T C 2: 23,168,288 F144S probably benign Het
Other mutations in Cxxc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01477:Cxxc1 APN 18 74219914 missense possibly damaging 0.83
IGL02250:Cxxc1 APN 18 74219169 missense probably benign 0.00
IGL02640:Cxxc1 APN 18 74221183 missense probably damaging 1.00
IGL02802:Cxxc1 UTSW 18 74219410 nonsense probably null
P0018:Cxxc1 UTSW 18 74220921 missense probably damaging 1.00
R0534:Cxxc1 UTSW 18 74218891 missense probably benign 0.00
R0557:Cxxc1 UTSW 18 74218774 missense possibly damaging 0.92
R0576:Cxxc1 UTSW 18 74220185 missense possibly damaging 0.47
R1539:Cxxc1 UTSW 18 74219207 missense possibly damaging 0.53
R1714:Cxxc1 UTSW 18 74219863 missense probably damaging 1.00
R4763:Cxxc1 UTSW 18 74219413 missense probably damaging 0.98
R5252:Cxxc1 UTSW 18 74219951 missense probably benign 0.30
R5890:Cxxc1 UTSW 18 74221166 missense possibly damaging 0.68
R6908:Cxxc1 UTSW 18 74220559 missense probably damaging 1.00
R7064:Cxxc1 UTSW 18 74220607 critical splice donor site probably null
R7305:Cxxc1 UTSW 18 74219396 missense probably benign 0.02
T0975:Cxxc1 UTSW 18 74220921 missense probably damaging 1.00
X0028:Cxxc1 UTSW 18 74218801 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCTAGCAAGTTCAGATGACAGCTC -3'
(R):5'- TCAGTTCCCAAGCAGCCTGTTC -3'

Sequencing Primer
(F):5'- TACCTTTGTTAGACAGGCAAGGC -3'
(R):5'- AAGCAGCCTGTTCCCCTC -3'
Posted On2013-07-30