Incidental Mutation 'R0673:Ankrd13d'
ID61547
Institutional Source Beutler Lab
Gene Symbol Ankrd13d
Ensembl Gene ENSMUSG00000005986
Gene Nameankyrin repeat domain 13 family, member D
Synonyms
MMRRC Submission 038858-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.706) question?
Stock #R0673 (G1)
Quality Score140
Status Not validated
Chromosome19
Chromosomal Location4270180-4283137 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 4273019 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000053783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037992] [ENSMUST00000056888] [ENSMUST00000113852] [ENSMUST00000163858] [ENSMUST00000166031] [ENSMUST00000169192]
Predicted Effect probably benign
Transcript: ENSMUST00000037992
SMART Domains Protein: ENSMUSP00000047718
Gene: ENSMUSG00000034616

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Pfam:DEK_C 268 321 3.3e-18 PFAM
DSPc 325 463 7.25e-42 SMART
low complexity region 488 507 N/A INTRINSIC
low complexity region 539 551 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
low complexity region 612 627 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000056888
SMART Domains Protein: ENSMUSP00000053783
Gene: ENSMUSG00000005986

DomainStartEndE-ValueType
ANK 39 68 2.77e-3 SMART
ANK 72 101 9.75e1 SMART
Pfam:GPCR_chapero_1 155 469 1.2e-111 PFAM
UIM 482 501 3.2e-2 SMART
UIM 528 547 1.92e2 SMART
UIM 564 583 8.18e0 SMART
UIM 589 605 6e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113852
SMART Domains Protein: ENSMUSP00000109483
Gene: ENSMUSG00000034616

DomainStartEndE-ValueType
low complexity region 25 37 N/A INTRINSIC
Pfam:DEK_C 273 324 1.1e-15 PFAM
DSPc 329 467 7.25e-42 SMART
low complexity region 492 511 N/A INTRINSIC
low complexity region 543 555 N/A INTRINSIC
low complexity region 598 610 N/A INTRINSIC
low complexity region 616 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163858
SMART Domains Protein: ENSMUSP00000128932
Gene: ENSMUSG00000005986

DomainStartEndE-ValueType
ANK 39 68 2.77e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166031
SMART Domains Protein: ENSMUSP00000130505
Gene: ENSMUSG00000005986

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169192
SMART Domains Protein: ENSMUSP00000130995
Gene: ENSMUSG00000005986

DomainStartEndE-ValueType
Blast:ANK 1 28 5e-11 BLAST
Pfam:GPCR_chapero_1 82 121 6.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170283
SMART Domains Protein: ENSMUSP00000126349
Gene: ENSMUSG00000005986

DomainStartEndE-ValueType
Pfam:GPCR_chapero_1 1 98 9.3e-25 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the ankyrin repeat domain (ANKRD) 13 family, which currently consists of four proteins containing ubiquitin-interacting motifs. These proteins are integral membrane proteins that bind specifically to Lys-63-linked ubiquitin chains on membrane-bound proteins, targeting those proteins for rapid internalization. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600014C23Rik C T 17: 45,733,073 W86* probably null Het
2700049A03Rik C T 12: 71,177,868 P894S probably damaging Het
Adgrg7 A T 16: 56,773,486 N122K possibly damaging Het
Blm A T 7: 80,499,751 probably null Het
Caml C T 13: 55,631,828 T238M probably damaging Het
Casd1 T A 6: 4,624,440 V411D possibly damaging Het
Cdc25b A G 2: 131,197,262 N516D probably benign Het
Cmya5 A G 13: 93,089,997 I2861T probably damaging Het
Csmd3 A G 15: 47,913,940 L1294P probably damaging Het
Cxxc1 A G 18: 74,218,913 D287G possibly damaging Het
Dgkq T C 5: 108,655,589 H217R probably damaging Het
Disp2 A T 2: 118,790,844 I686F possibly damaging Het
Dnah6 T A 6: 73,123,811 N2003I probably benign Het
Dsc3 T A 18: 19,989,590 R92S probably damaging Het
Ei24 T G 9: 36,788,255 probably null Het
Fgl1 G T 8: 41,191,624 T281K probably benign Het
Gbp3 A G 3: 142,565,254 T140A probably benign Het
Gtpbp3 A T 8: 71,492,735 I485F probably damaging Het
Harbi1 C T 2: 91,712,535 R114W probably damaging Het
Inmt A C 6: 55,171,227 V139G probably damaging Het
Inpp5j T A 11: 3,501,147 M501L probably benign Het
Jmjd1c A G 10: 67,226,809 N1647S probably damaging Het
Lgals9 A G 11: 78,965,853 F252L probably damaging Het
Lingo3 C A 10: 80,835,784 R104L probably benign Het
Lrrc8c G A 5: 105,607,678 V440M probably damaging Het
Mybpc3 G A 2: 91,120,427 G36D probably damaging Het
Ncapd3 T A 9: 27,087,477 N1254K probably benign Het
Neb A G 2: 52,256,124 V2947A possibly damaging Het
Nudt12 A T 17: 59,007,622 probably null Het
Olfr140 A C 2: 90,052,252 M24R probably benign Het
Olfr167 A G 16: 19,515,396 M80T probably damaging Het
Otop1 T C 5: 38,287,948 V150A possibly damaging Het
Prr14l C T 5: 32,828,915 D1079N probably benign Het
Rasal1 A G 5: 120,670,384 T494A probably benign Het
Sacs A G 14: 61,210,215 K3237E possibly damaging Het
Sh3d19 T C 3: 86,106,973 S415P probably benign Het
Sypl A T 12: 32,965,421 T40S probably damaging Het
Tg A T 15: 66,741,484 probably null Het
Tmed8 A G 12: 87,174,104 V236A probably damaging Het
Vmn1r33 T C 6: 66,611,799 Y257C probably damaging Het
Yme1l1 T C 2: 23,168,288 F144S probably benign Het
Other mutations in Ankrd13d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01485:Ankrd13d APN 19 4273564 missense probably benign 0.21
IGL02480:Ankrd13d APN 19 4271463 missense possibly damaging 0.67
R0639:Ankrd13d UTSW 19 4273019 critical splice donor site probably null
R1423:Ankrd13d UTSW 19 4281069 missense probably damaging 1.00
R1592:Ankrd13d UTSW 19 4282891 missense probably benign 0.21
R1682:Ankrd13d UTSW 19 4282933 missense probably damaging 1.00
R1843:Ankrd13d UTSW 19 4271595 missense probably damaging 0.99
R2277:Ankrd13d UTSW 19 4280984 missense probably benign 0.03
R2376:Ankrd13d UTSW 19 4272595 missense possibly damaging 0.79
R2483:Ankrd13d UTSW 19 4281940 missense probably damaging 0.96
R3623:Ankrd13d UTSW 19 4281940 missense probably damaging 0.96
R4066:Ankrd13d UTSW 19 4270360 missense probably benign 0.00
R5871:Ankrd13d UTSW 19 4281994 missense possibly damaging 0.92
R6011:Ankrd13d UTSW 19 4281934 missense probably damaging 1.00
R6057:Ankrd13d UTSW 19 4282228 missense probably damaging 0.97
R6167:Ankrd13d UTSW 19 4273053 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTATGCACAAGGAGAAAGCACC -3'
(R):5'- TGATTGTGAGGAATGGGCTCTGAAC -3'

Sequencing Primer
(F):5'- GCAAGCTCACCAAAGTGTG -3'
(R):5'- AATGGGCTCTGAACCCTGAG -3'
Posted On2013-07-30