Incidental Mutation 'R0677:Galnt5'
ID61666
Institutional Source Beutler Lab
Gene Symbol Galnt5
Ensembl Gene ENSMUSG00000026828
Gene Namepolypeptide N-acetylgalactosaminyltransferase 5
SynonymsppGaNTase-T5
MMRRC Submission 038862-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0677 (G1)
Quality Score92
Status Not validated
Chromosome2
Chromosomal Location57997884-58045860 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 57998980 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 197 (Y197*)
Ref Sequence ENSEMBL: ENSMUSP00000131362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112616] [ENSMUST00000166729]
Predicted Effect probably null
Transcript: ENSMUST00000112616
AA Change: Y197*
SMART Domains Protein: ENSMUSP00000108235
Gene: ENSMUSG00000026828
AA Change: Y197*

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Pfam:Glycos_transf_2 489 672 1.3e-33 PFAM
Pfam:Glyco_transf_7C 653 718 1.9e-8 PFAM
RICIN 801 925 1.36e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144671
Predicted Effect probably null
Transcript: ENSMUST00000166729
AA Change: Y197*
SMART Domains Protein: ENSMUSP00000131362
Gene: ENSMUSG00000026828
AA Change: Y197*

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Pfam:Glycos_transf_2 489 672 2.1e-30 PFAM
Pfam:Glyco_transf_7C 652 718 7e-8 PFAM
RICIN 801 925 1.36e-19 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound polypeptide N-acetylgalactosaminyltransferase that is found in the Golgi. The encoded protein catalyzes the first step in the mucin-type O-glycosylation of Golgi proteins, transfering an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor. [provided by RefSeq, Aug 2016]
PHENOTYPE: An unpublished knockout mutation is reported to have no overt phenotypic consequences. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,970,952 L59* probably null Het
A630073D07Rik G A 6: 132,626,557 Q79* probably null Het
Apol8 A C 15: 77,749,851 I175S probably damaging Het
BC004004 T C 17: 29,298,664 F284S probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Dchs1 G A 7: 105,764,984 R875C probably damaging Het
Depdc5 A C 5: 32,901,470 N261T probably damaging Het
Flrt1 A T 19: 7,096,179 C334* probably null Het
Gp5 A G 16: 30,308,375 S494P probably benign Het
Ifnlr1 T A 4: 135,705,634 D460E possibly damaging Het
Mrgpra4 C T 7: 47,980,980 S291N probably benign Het
Msh4 G A 3: 153,879,367 P367S possibly damaging Het
Myct1 G T 10: 5,604,261 V43F probably benign Het
Ndst2 G A 14: 20,729,579 R198W probably benign Het
Ogdhl A T 14: 32,339,925 H500L probably damaging Het
Olfr593 C T 7: 103,212,798 R302* probably null Het
Olfr769 T A 10: 129,112,078 M116L probably damaging Het
Pkhd1 C T 1: 20,524,230 G1220S probably benign Het
Slc26a4 A G 12: 31,549,911 probably null Het
Sytl1 A T 4: 133,253,225 C551S possibly damaging Het
Uri1 T C 7: 37,965,500 N256D probably benign Het
Vmn2r114 T G 17: 23,310,594 D178A probably damaging Het
Vmn2r23 C T 6: 123,713,451 L429F probably benign Het
Washc2 T C 6: 116,244,616 L685P probably damaging Het
Wipi2 A T 5: 142,658,234 I124F probably damaging Het
Other mutations in Galnt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Galnt5 APN 2 57998973 missense probably benign
IGL00515:Galnt5 APN 2 57999068 missense probably benign 0.02
IGL00950:Galnt5 APN 2 57999132 missense probably benign 0.00
IGL00973:Galnt5 APN 2 57998939 missense probably benign 0.02
IGL01152:Galnt5 APN 2 58025393 missense probably benign 0.17
IGL01305:Galnt5 APN 2 58025342 nonsense probably null
IGL01661:Galnt5 APN 2 57999482 missense probably benign 0.03
IGL01719:Galnt5 APN 2 57998543 missense probably damaging 1.00
IGL02165:Galnt5 APN 2 57998865 missense probably benign
IGL02795:Galnt5 APN 2 58027871 missense probably damaging 1.00
IGL02943:Galnt5 APN 2 57999768 missense probably damaging 1.00
IGL03218:Galnt5 APN 2 57999389 missense possibly damaging 0.59
ANU22:Galnt5 UTSW 2 58025342 nonsense probably null
R0082:Galnt5 UTSW 2 57999035 missense possibly damaging 0.92
R0113:Galnt5 UTSW 2 57998877 missense probably benign
R0445:Galnt5 UTSW 2 57998950 missense probably benign
R0517:Galnt5 UTSW 2 58035373 splice site probably benign
R0609:Galnt5 UTSW 2 58024625 missense possibly damaging 0.90
R0639:Galnt5 UTSW 2 57999395 missense probably benign 0.07
R0646:Galnt5 UTSW 2 57999085 missense probably benign 0.00
R1808:Galnt5 UTSW 2 58026125 missense probably benign 0.24
R1927:Galnt5 UTSW 2 57998603 missense probably benign 0.00
R1980:Galnt5 UTSW 2 58024723 critical splice donor site probably null
R2517:Galnt5 UTSW 2 57999413 missense probably benign 0.00
R4044:Galnt5 UTSW 2 57998460 missense probably damaging 1.00
R4154:Galnt5 UTSW 2 57998493 missense probably damaging 1.00
R4411:Galnt5 UTSW 2 57999195 missense probably benign 0.01
R4703:Galnt5 UTSW 2 57998907 missense possibly damaging 0.96
R4767:Galnt5 UTSW 2 58028144 missense possibly damaging 0.91
R5118:Galnt5 UTSW 2 58015003 missense probably damaging 1.00
R5497:Galnt5 UTSW 2 58025328 missense probably damaging 0.99
R5506:Galnt5 UTSW 2 57999625 missense probably benign
R5548:Galnt5 UTSW 2 58014910 missense probably damaging 0.99
R5758:Galnt5 UTSW 2 57998430 missense probably benign 0.19
R5937:Galnt5 UTSW 2 58038937 missense probably benign 0.00
R6237:Galnt5 UTSW 2 58035249 missense probably damaging 0.96
R6805:Galnt5 UTSW 2 58035299 missense possibly damaging 0.82
R6959:Galnt5 UTSW 2 57999219 missense probably benign 0.39
R7070:Galnt5 UTSW 2 57998609 missense probably benign 0.00
R7179:Galnt5 UTSW 2 57998609 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATAGCAAGCCTGAAGTCTCCTCCC -3'
(R):5'- TGGCTGCATCATCTTCTGGCAATC -3'

Sequencing Primer
(F):5'- TCCCAATACATGATGTCCAAGTGG -3'
(R):5'- TGGCAATCTTCCCAACTGTG -3'
Posted On2013-07-30