Mutagenetix > Incidental Mutation

Incidental Mutation 'R0678:Thbs1'

61698

Institutional Source

Beutler Lab

Gene Symbol

Thbs1

Ensembl Gene

ENSMUSG00000040152

Gene Name

thrombospondin 1

Synonyms

TSP-1, TSP1, tbsp1, Thbs-1

MMRRC Submission

038863-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0678 (G1)

Quality Score

107

Status

Not validated

Chromosome

Chromosomal Location

117942357-117957614 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 117953387 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 935 (F935L)

Ref Sequence

ENSEMBL: ENSMUSP00000044903 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039559]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000039559
AA Change: F935L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000044903
Gene: ENSMUSG00000040152
AA Change: F935L

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
TSPN	24	221	2.68e-60	SMART
low complexity region	237	249	N/A	INTRINSIC
coiled coil region	292	315	N/A	INTRINSIC
VWC	319	373	3.6e-20	SMART
TSP1	383	430	4.21e-12	SMART
TSP1	439	491	3.04e-18	SMART
TSP1	496	548	8.6e-18	SMART
EGF	551	588	3.88e-3	SMART
EGF	592	646	1.69e1	SMART
EGF	650	691	7.13e-2	SMART
Pfam:TSP_3	728	763	5.8e-12	PFAM
Pfam:TSP_3	763	786	2.1e-5	PFAM
Pfam:TSP_3	787	822	3.3e-13	PFAM
Pfam:TSP_3	822	845	1.1e-6	PFAM
Pfam:TSP_3	846	883	2e-15	PFAM
Pfam:TSP_3	884	919	8.3e-13	PFAM
Pfam:TSP_3	920	954	4.9e-10	PFAM
Pfam:TSP_C	973	1170	1.4e-99	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142588

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190311

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is a subunit of a disulfide-linked homotrimeric protein. This protein is an adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. This protein can bind to fibrinogen, fibronectin, laminin, type V collagen and integrins alpha-V/beta-1. This protein has been shown to play roles in platelet aggregation, angiogenesis, and tumorigenesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice show partial prenatal lethality, lordosis, kyphosis, leukocytosis, multiorgan inflammation, lung hemorrhage, pneumonia, resistance to radiation and ischemic injury, altered blood pressure and vasoactive stress responses, eye pathology, and corneal and lacrimal gland dysfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Egfl7	C	T	2: 26,480,952 (GRCm39)	R155C	probably benign	Het
Fat4	T	C	3: 38,943,843 (GRCm39)	I912T	probably damaging	Het
H2-M5	A	G	17: 37,300,034 (GRCm39)	F47L	possibly damaging	Het
H2-T24	A	T	17: 36,328,333 (GRCm39)	F50Y	probably damaging	Het
Hif1a	A	G	12: 73,990,965 (GRCm39)		probably null	Het
Ints11	T	C	4: 155,972,210 (GRCm39)	I405T	probably damaging	Het
Kmt2d	A	T	15: 98,748,294 (GRCm39)		probably benign	Het
Pld1	T	A	3: 28,174,933 (GRCm39)	V857D	probably damaging	Het
Ptgr3	A	G	18: 84,113,287 (GRCm39)	E321G	probably benign	Het
Rab11fip3	G	A	17: 26,287,821 (GRCm39)	P111S	probably benign	Het
Rad17	A	T	13: 100,781,692 (GRCm39)	I35N	possibly damaging	Het
Rnf31	C	A	14: 55,839,170 (GRCm39)	Y66*	probably null	Het
Sec31a	T	C	5: 100,555,084 (GRCm39)	I45M	possibly damaging	Het
Sele	T	C	1: 163,882,298 (GRCm39)		probably null	Het
Serpina3i	G	T	12: 104,232,978 (GRCm39)		probably null	Het
Sp6	T	A	11: 96,912,607 (GRCm39)	W107R	probably damaging	Het
Sphkap	A	T	1: 83,256,349 (GRCm39)	W467R	probably benign	Het
Vmn2r8	T	A	5: 108,948,412 (GRCm39)	H492L	probably benign	Het
Xrcc2	A	G	5: 25,903,261 (GRCm39)	S37P	possibly damaging	Het
Zfand1	T	A	3: 10,413,577 (GRCm39)	I31L	probably benign	Het
Zfr	G	A	15: 12,184,171 (GRCm39)	D1058N	probably damaging	Het

Other mutations in Thbs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00801:Thbs1	APN	2	117,953,454 (GRCm39)	missense	probably damaging	1.00
IGL00920:Thbs1	APN	2	117,943,682 (GRCm39)	missense	probably damaging	0.99
IGL01295:Thbs1	APN	2	117,948,808 (GRCm39)	missense	possibly damaging	0.88
IGL01649:Thbs1	APN	2	117,945,463 (GRCm39)	missense	probably benign
IGL02077:Thbs1	APN	2	117,943,591 (GRCm39)	missense	probably benign	0.00
IGL02251:Thbs1	APN	2	117,943,999 (GRCm39)	missense	probably benign	0.00
IGL02263:Thbs1	APN	2	117,950,361 (GRCm39)	missense	probably benign	0.06
IGL02392:Thbs1	APN	2	117,945,141 (GRCm39)	missense	probably benign
IGL02393:Thbs1	APN	2	117,953,580 (GRCm39)	missense	possibly damaging	0.87
IGL02411:Thbs1	APN	2	117,945,451 (GRCm39)	missense	probably benign
IGL02659:Thbs1	APN	2	117,945,273 (GRCm39)	missense	probably benign	0.29
Stark	UTSW	2	117,951,718 (GRCm39)	critical splice donor site	probably null
R0014:Thbs1	UTSW	2	117,943,831 (GRCm39)	missense	possibly damaging	0.51
R0042:Thbs1	UTSW	2	117,953,358 (GRCm39)	missense	probably damaging	1.00
R0064:Thbs1	UTSW	2	117,954,395 (GRCm39)	critical splice acceptor site	probably null
R0240:Thbs1	UTSW	2	117,944,874 (GRCm39)	missense	probably damaging	1.00
R0240:Thbs1	UTSW	2	117,944,874 (GRCm39)	missense	probably damaging	1.00
R0316:Thbs1	UTSW	2	117,948,055 (GRCm39)	missense	probably damaging	1.00
R0393:Thbs1	UTSW	2	117,943,472 (GRCm39)	missense	possibly damaging	0.69
R1037:Thbs1	UTSW	2	117,953,532 (GRCm39)	missense	probably damaging	1.00
R1440:Thbs1	UTSW	2	117,944,836 (GRCm39)	missense	probably damaging	1.00
R1454:Thbs1	UTSW	2	117,953,153 (GRCm39)	missense	probably damaging	1.00
R1571:Thbs1	UTSW	2	117,949,678 (GRCm39)	missense	probably damaging	0.99
R1702:Thbs1	UTSW	2	117,943,923 (GRCm39)	missense	probably benign
R2035:Thbs1	UTSW	2	117,948,821 (GRCm39)	critical splice donor site	probably null
R2068:Thbs1	UTSW	2	117,954,018 (GRCm39)	nonsense	probably null
R2171:Thbs1	UTSW	2	117,953,060 (GRCm39)	missense	probably damaging	1.00
R2844:Thbs1	UTSW	2	117,948,109 (GRCm39)	missense	probably benign	0.00
R2870:Thbs1	UTSW	2	117,949,859 (GRCm39)	missense	probably damaging	1.00
R2870:Thbs1	UTSW	2	117,949,859 (GRCm39)	missense	probably damaging	1.00
R3620:Thbs1	UTSW	2	117,951,640 (GRCm39)	missense	probably benign	0.05
R3621:Thbs1	UTSW	2	117,951,640 (GRCm39)	missense	probably benign	0.05
R3726:Thbs1	UTSW	2	117,945,191 (GRCm39)	missense	probably benign	0.02
R4499:Thbs1	UTSW	2	117,950,431 (GRCm39)	missense	possibly damaging	0.82
R4524:Thbs1	UTSW	2	117,953,460 (GRCm39)	missense	probably damaging	1.00
R4576:Thbs1	UTSW	2	117,949,897 (GRCm39)	missense	probably damaging	0.97
R4596:Thbs1	UTSW	2	117,945,236 (GRCm39)	missense	possibly damaging	0.80
R4646:Thbs1	UTSW	2	117,948,810 (GRCm39)	missense	probably benign	0.15
R4783:Thbs1	UTSW	2	117,945,273 (GRCm39)	missense	probably benign	0.04
R4836:Thbs1	UTSW	2	117,945,499 (GRCm39)	missense	possibly damaging	0.91
R4943:Thbs1	UTSW	2	117,943,930 (GRCm39)	missense	probably damaging	1.00
R4967:Thbs1	UTSW	2	117,945,259 (GRCm39)	missense	probably benign
R5014:Thbs1	UTSW	2	117,950,518 (GRCm39)	critical splice donor site	probably null
R5062:Thbs1	UTSW	2	117,951,718 (GRCm39)	critical splice donor site	probably null
R5363:Thbs1	UTSW	2	117,953,147 (GRCm39)	missense	probably damaging	1.00
R5420:Thbs1	UTSW	2	117,943,636 (GRCm39)	missense	possibly damaging	0.83
R5432:Thbs1	UTSW	2	117,945,164 (GRCm39)	missense	probably benign	0.25
R5788:Thbs1	UTSW	2	117,952,989 (GRCm39)	missense	probably damaging	1.00
R6221:Thbs1	UTSW	2	117,950,478 (GRCm39)	missense	probably damaging	1.00
R6327:Thbs1	UTSW	2	117,943,137 (GRCm39)	missense	unknown
R6466:Thbs1	UTSW	2	117,950,328 (GRCm39)	missense	probably damaging	1.00
R6480:Thbs1	UTSW	2	117,949,598 (GRCm39)	missense	probably damaging	1.00
R6794:Thbs1	UTSW	2	117,950,519 (GRCm39)	splice site	probably null
R6983:Thbs1	UTSW	2	117,950,433 (GRCm39)	missense	probably damaging	1.00
R7284:Thbs1	UTSW	2	117,949,837 (GRCm39)	missense	probably damaging	1.00
R7320:Thbs1	UTSW	2	117,945,438 (GRCm39)	missense	possibly damaging	0.80
R7467:Thbs1	UTSW	2	117,948,681 (GRCm39)	missense	probably damaging	1.00
R7542:Thbs1	UTSW	2	117,951,655 (GRCm39)	missense	probably damaging	1.00
R7552:Thbs1	UTSW	2	117,943,843 (GRCm39)	missense	possibly damaging	0.90
R7575:Thbs1	UTSW	2	117,953,409 (GRCm39)	missense	probably damaging	1.00
R7870:Thbs1	UTSW	2	117,945,508 (GRCm39)	missense	possibly damaging	0.46
R7943:Thbs1	UTSW	2	117,950,098 (GRCm39)	splice site	probably null
R8267:Thbs1	UTSW	2	117,952,994 (GRCm39)	missense	probably damaging	1.00
R8402:Thbs1	UTSW	2	117,946,359 (GRCm39)	missense	possibly damaging	0.88
R8672:Thbs1	UTSW	2	117,943,719 (GRCm39)	missense	probably benign
R8726:Thbs1	UTSW	2	117,949,957 (GRCm39)	critical splice donor site	probably null
R8784:Thbs1	UTSW	2	117,943,613 (GRCm39)	missense	probably damaging	0.99
R9010:Thbs1	UTSW	2	117,953,045 (GRCm39)	missense	probably damaging	1.00
R9353:Thbs1	UTSW	2	117,953,051 (GRCm39)	missense	probably damaging	1.00
R9416:Thbs1	UTSW	2	117,947,983 (GRCm39)	missense	probably benign	0.11
R9474:Thbs1	UTSW	2	117,950,518 (GRCm39)	critical splice donor site	probably null
R9544:Thbs1	UTSW	2	117,953,932 (GRCm39)	missense	probably damaging	1.00
R9663:Thbs1	UTSW	2	117,949,897 (GRCm39)	missense	probably damaging	0.97
R9701:Thbs1	UTSW	2	117,950,716 (GRCm39)	missense	probably benign	0.05
RF039:Thbs1	UTSW	2	117,953,346 (GRCm39)	critical splice acceptor site	probably benign
RF054:Thbs1	UTSW	2	117,953,346 (GRCm39)	critical splice acceptor site	probably benign
X0019:Thbs1	UTSW	2	117,943,463 (GRCm39)	missense	probably damaging	1.00
Z1176:Thbs1	UTSW	2	117,953,403 (GRCm39)	missense	probably damaging	1.00
Z1176:Thbs1	UTSW	2	117,951,458 (GRCm39)	missense	probably benign	0.25
Z1176:Thbs1	UTSW	2	117,943,960 (GRCm39)	missense	probably benign	0.34
Z1177:Thbs1	UTSW	2	117,948,139 (GRCm39)	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGACAATGACGGCATCCCTGATGAC -3'
(R):5'- TTCTTTGCCCTGATGGCGGACAAC -3'

Sequencing Primer
(F):5'- GGCATAACTGACATCTTGGC -3'
(R):5'- GACAACCCAGTTAGGGTCATTTTG -3'

Posted On

2013-07-30