Incidental Mutation 'R0678:Rnf31'
ID61712
Institutional Source Beutler Lab
Gene Symbol Rnf31
Ensembl Gene ENSMUSG00000047098
Gene Namering finger protein 31
SynonymsPaul, HOIP
MMRRC Submission 038863-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0678 (G1)
Quality Score187
Status Not validated
Chromosome14
Chromosomal Location55591708-55603693 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 55601713 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 66 (Y66*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019443] [ENSMUST00000130697] [ENSMUST00000134863] [ENSMUST00000137296] [ENSMUST00000138037]
Predicted Effect probably null
Transcript: ENSMUST00000019443
AA Change: Y927*
SMART Domains Protein: ENSMUSP00000019443
Gene: ENSMUSG00000047098
AA Change: Y927*

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:PUB 68 148 7.1e-17 PFAM
low complexity region 262 294 N/A INTRINSIC
ZnF_RBZ 298 322 2.56e-1 SMART
ZnF_RBZ 346 370 6.93e-5 SMART
ZnF_RBZ 405 429 4.86e-1 SMART
Pfam:HOIP-UBA 477 622 2.4e-54 PFAM
Blast:RING 693 741 7e-25 BLAST
IBR 773 835 3.18e-14 SMART
IBR 847 924 5.35e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130697
SMART Domains Protein: ENSMUSP00000120359
Gene: ENSMUSG00000002325

DomainStartEndE-ValueType
IRF 5 117 1.19e-53 SMART
low complexity region 158 182 N/A INTRINSIC
low complexity region 185 194 N/A INTRINSIC
IRF-3 211 377 1.13e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133903
Predicted Effect probably benign
Transcript: ENSMUST00000134863
SMART Domains Protein: ENSMUSP00000120525
Gene: ENSMUSG00000002325

DomainStartEndE-ValueType
low complexity region 34 58 N/A INTRINSIC
IRF 71 183 1.19e-53 SMART
low complexity region 224 248 N/A INTRINSIC
low complexity region 251 260 N/A INTRINSIC
IRF-3 277 443 1.13e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137296
SMART Domains Protein: ENSMUSP00000122955
Gene: ENSMUSG00000047098

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
Pfam:PUB 66 151 6.8e-17 PFAM
Blast:RING 214 257 3e-17 BLAST
low complexity region 262 294 N/A INTRINSIC
ZnF_RBZ 298 322 2.56e-1 SMART
ZnF_RBZ 346 370 6.93e-5 SMART
ZnF_RBZ 404 428 4.86e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138037
SMART Domains Protein: ENSMUSP00000119477
Gene: ENSMUSG00000002325

DomainStartEndE-ValueType
IRF 23 135 1.19e-53 SMART
low complexity region 176 200 N/A INTRINSIC
low complexity region 203 212 N/A INTRINSIC
IRF-3 229 395 1.13e-59 SMART
Predicted Effect probably null
Transcript: ENSMUST00000140178
AA Change: Y772*
SMART Domains Protein: ENSMUSP00000118215
Gene: ENSMUSG00000047098
AA Change: Y772*

DomainStartEndE-ValueType
PDB:4OYJ|M 2 85 1e-29 PDB
low complexity region 164 196 N/A INTRINSIC
ZnF_RBZ 200 224 2.56e-1 SMART
ZnF_RBZ 248 272 6.93e-5 SMART
ZnF_RBZ 307 331 4.86e-1 SMART
Pfam:HOIP-UBA 369 468 1.1e-31 PFAM
Blast:RING 539 587 9e-25 BLAST
IBR 619 681 3.18e-14 SMART
IBR 693 770 5.35e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145680
Predicted Effect probably null
Transcript: ENSMUST00000227708
AA Change: Y66*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. The encoded protein is the E3 ubiquitin-protein ligase component of the linear ubiquitin chain assembly complex. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality. Mice homozygous for a conditional allele activated in B cells exhibit severely impaired B1 B cell development and impaired antibody responses to both T cell-dependent and T cell-independent type 2 antigens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Egfl7 C T 2: 26,590,940 R155C probably benign Het
Fat4 T C 3: 38,889,694 I912T probably damaging Het
H2-M5 A G 17: 36,989,142 F47L possibly damaging Het
H2-T24 A T 17: 36,017,441 F50Y probably damaging Het
Hif1a A G 12: 73,944,191 probably null Het
Ints11 T C 4: 155,887,753 I405T probably damaging Het
Kmt2d A T 15: 98,850,413 probably benign Het
Pld1 T A 3: 28,120,784 V857D probably damaging Het
Rab11fip3 G A 17: 26,068,847 P111S probably benign Het
Rad17 A T 13: 100,645,184 I35N possibly damaging Het
Sec31a T C 5: 100,407,225 I45M possibly damaging Het
Sele T C 1: 164,054,729 probably null Het
Serpina3i G T 12: 104,266,719 probably null Het
Sp6 T A 11: 97,021,781 W107R probably damaging Het
Sphkap A T 1: 83,278,628 W467R probably benign Het
Thbs1 T C 2: 118,122,906 F935L probably damaging Het
Vmn2r8 T A 5: 108,800,546 H492L probably benign Het
Xrcc2 A G 5: 25,698,263 S37P possibly damaging Het
Zadh2 A G 18: 84,095,162 E321G probably benign Het
Zfand1 T A 3: 10,348,517 I31L probably benign Het
Zfr G A 15: 12,184,085 D1058N probably damaging Het
Other mutations in Rnf31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rnf31 APN 14 55592319 splice site probably null
IGL01532:Rnf31 APN 14 55602623 missense probably damaging 0.99
IGL02118:Rnf31 APN 14 55599112 missense probably damaging 1.00
IGL02272:Rnf31 APN 14 55598782 missense probably damaging 1.00
IGL02893:Rnf31 APN 14 55599109 missense probably damaging 1.00
IGL02939:Rnf31 APN 14 55595674 missense probably benign 0.30
R0285:Rnf31 UTSW 14 55601389 missense probably damaging 0.96
R0924:Rnf31 UTSW 14 55593002 unclassified probably benign
R1386:Rnf31 UTSW 14 55596764 missense probably damaging 1.00
R1507:Rnf31 UTSW 14 55598982 nonsense probably null
R2122:Rnf31 UTSW 14 55596197 missense probably damaging 1.00
R2164:Rnf31 UTSW 14 55592537 missense possibly damaging 0.90
R3714:Rnf31 UTSW 14 55603394 missense probably damaging 1.00
R3921:Rnf31 UTSW 14 55601142 missense probably damaging 1.00
R4348:Rnf31 UTSW 14 55601098 frame shift probably null
R4349:Rnf31 UTSW 14 55601098 frame shift probably null
R4350:Rnf31 UTSW 14 55601098 frame shift probably null
R4351:Rnf31 UTSW 14 55601098 frame shift probably null
R4353:Rnf31 UTSW 14 55601098 frame shift probably null
R4472:Rnf31 UTSW 14 55603320 missense probably damaging 1.00
R5004:Rnf31 UTSW 14 55592182 missense probably damaging 1.00
R5245:Rnf31 UTSW 14 55601706 missense probably damaging 1.00
R5286:Rnf31 UTSW 14 55592236 missense probably damaging 1.00
R5669:Rnf31 UTSW 14 55596704 missense probably damaging 1.00
R5750:Rnf31 UTSW 14 55598686 missense probably damaging 1.00
R6377:Rnf31 UTSW 14 55595527 missense probably damaging 1.00
R7009:Rnf31 UTSW 14 55592551 missense probably benign 0.00
R7018:Rnf31 UTSW 14 55592233 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAACGCCTTTTACGCCAAGAATG -3'
(R):5'- TCTGACACTTACCTCCAGGGACTG -3'

Sequencing Primer
(F):5'- CCTTTTACGCCAAGAATGTGAGTG -3'
(R):5'- AGCTGGAGGCTCTGTATTAAAC -3'
Posted On2013-07-30