Incidental Mutation 'R0680:Dennd2a'
ID61743
Institutional Source Beutler Lab
Gene Symbol Dennd2a
Ensembl Gene ENSMUSG00000038456
Gene NameDENN/MADD domain containing 2A
Synonyms
MMRRC Submission 038865-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R0680 (G1)
Quality Score143
Status Not validated
Chromosome6
Chromosomal Location39462378-39557867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39483062 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 703 (L703Q)
Ref Sequence ENSEMBL: ENSMUSP00000045367 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036877]
Predicted Effect probably damaging
Transcript: ENSMUST00000036877
AA Change: L703Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000045367
Gene: ENSMUSG00000038456
AA Change: L703Q

DomainStartEndE-ValueType
Blast:DENN 9 430 1e-149 BLAST
low complexity region 445 457 N/A INTRINSIC
low complexity region 508 520 N/A INTRINSIC
uDENN 554 646 2.06e-31 SMART
DENN 653 837 7.1e-76 SMART
dDENN 888 953 1.84e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149162
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202707
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik T A 10: 3,125,133 noncoding transcript Het
AI481877 T C 4: 59,043,967 D1449G probably benign Het
Clca4a A T 3: 144,969,367 F167L probably damaging Het
Col6a3 T C 1: 90,778,981 M2137V unknown Het
Fsip2 T A 2: 82,991,359 I5812N possibly damaging Het
Gen1 T A 12: 11,241,869 S640C probably benign Het
Il9 T C 13: 56,481,880 T61A probably benign Het
Lrp1 A G 10: 127,589,661 L700P probably damaging Het
Lyst G A 13: 13,650,341 V1514I probably benign Het
Med1 A T 11: 98,180,166 probably null Het
Olfr1205 A T 2: 88,831,780 Y221F probably benign Het
Olfr298 A T 7: 86,489,337 F71L probably benign Het
Olfr666 A G 7: 104,893,004 I208T probably benign Het
Olfr810 T A 10: 129,790,818 Y257F probably damaging Het
Pcdhb18 G C 18: 37,490,294 A226P probably damaging Het
Pirb T A 7: 3,717,361 N338Y possibly damaging Het
Rc3h2 A C 2: 37,399,835 I360R probably damaging Het
Rnf139 T C 15: 58,899,652 Y509H probably damaging Het
Shisa7 T A 7: 4,831,723 D279V probably benign Het
Slc6a3 T C 13: 73,538,727 L71P probably damaging Het
Slc9a5 T A 8: 105,355,907 L268Q probably null Het
St7 T C 6: 17,942,733 S563P probably damaging Het
Stx1b A G 7: 127,807,723 V240A possibly damaging Het
Sugt1 A G 14: 79,610,311 I200M possibly damaging Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Ube4a T A 9: 44,948,060 Q380L probably damaging Het
Ugt1a2 A G 1: 88,201,211 Y192C probably damaging Het
Unc93b1 G A 19: 3,947,093 V505I probably benign Het
Usp29 T C 7: 6,962,885 S576P possibly damaging Het
Vcan A T 13: 89,679,822 H2208Q probably damaging Het
Zcchc6 G A 13: 59,800,599 T636I possibly damaging Het
Zfp106 T A 2: 120,527,016 S1133C probably damaging Het
Zfp148 A G 16: 33,495,804 D282G possibly damaging Het
Zswim9 A C 7: 13,260,321 V636G probably benign Het
Other mutations in Dennd2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Dennd2a APN 6 39523136 missense probably damaging 1.00
IGL01482:Dennd2a APN 6 39480309 missense probably damaging 0.98
IGL02135:Dennd2a APN 6 39480271 nonsense probably null
IGL02206:Dennd2a APN 6 39523449 missense probably damaging 1.00
IGL02649:Dennd2a APN 6 39470356 missense probably benign 0.11
IGL03057:Dennd2a APN 6 39508248 missense probably damaging 0.98
R0310:Dennd2a UTSW 6 39464201 splice site probably benign
R0326:Dennd2a UTSW 6 39497110 missense probably damaging 1.00
R0360:Dennd2a UTSW 6 39508299 missense probably benign 0.13
R0364:Dennd2a UTSW 6 39508299 missense probably benign 0.13
R0394:Dennd2a UTSW 6 39522812 missense possibly damaging 0.92
R1741:Dennd2a UTSW 6 39493157 missense probably damaging 0.99
R1744:Dennd2a UTSW 6 39480251 missense probably benign 0.26
R2070:Dennd2a UTSW 6 39465119 missense probably damaging 1.00
R3833:Dennd2a UTSW 6 39506717 missense probably damaging 0.97
R3833:Dennd2a UTSW 6 39506723 missense probably damaging 0.98
R4120:Dennd2a UTSW 6 39465096 missense probably damaging 0.99
R4583:Dennd2a UTSW 6 39522842 missense probably damaging 1.00
R4842:Dennd2a UTSW 6 39497110 missense probably damaging 1.00
R4887:Dennd2a UTSW 6 39497159 missense probably benign 0.03
R4901:Dennd2a UTSW 6 39522687 missense probably benign 0.00
R5065:Dennd2a UTSW 6 39495176 critical splice donor site probably null
R5413:Dennd2a UTSW 6 39464293 missense probably damaging 1.00
R6181:Dennd2a UTSW 6 39485620 missense probably benign 0.14
R6239:Dennd2a UTSW 6 39488816 missense probably damaging 1.00
R6360:Dennd2a UTSW 6 39493142 missense probably benign 0.01
R7115:Dennd2a UTSW 6 39506711 missense probably damaging 1.00
X0026:Dennd2a UTSW 6 39508367 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- ACTGGATGCCCTGCTGAAAGACAC -3'
(R):5'- AGGGAAACGACTTTACGCCCCTAC -3'

Sequencing Primer
(F):5'- TGCTGAAAGACACAGCCTCTC -3'
(R):5'- TTTACGCCCCTACGAAGC -3'
Posted On2013-07-30