Incidental Mutation 'R0659:Slitrk5'
ID61802
Institutional Source Beutler Lab
Gene Symbol Slitrk5
Ensembl Gene ENSMUSG00000033214
Gene NameSLIT and NTRK-like family, member 5
Synonyms2610019D03Rik
MMRRC Submission 038844-MU
Accession Numbers

Ncbi RefSeq: NM_198865.1; MGI:2679448

Is this an essential gene? Possibly essential (E-score: 0.502) question?
Stock #R0659 (G1)
Quality Score84
Status Validated
Chromosome14
Chromosomal Location111675097-111683141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111680689 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 582 (K582E)
Ref Sequence ENSEMBL: ENSMUSP00000041499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042767] [ENSMUST00000227891]
Predicted Effect probably benign
Transcript: ENSMUST00000042767
AA Change: K582E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000041499
Gene: ENSMUSG00000033214
AA Change: K582E

DomainStartEndE-ValueType
Blast:LRRNT 47 85 3e-18 BLAST
low complexity region 86 96 N/A INTRINSIC
LRR 108 127 2.76e2 SMART
LRR_TYP 128 151 1.67e-2 SMART
LRR 152 175 2.67e-1 SMART
LRR 176 199 1.08e-1 SMART
LRR 202 223 7.38e1 SMART
LRRCT 235 285 2.13e-5 SMART
low complexity region 308 323 N/A INTRINSIC
LRRNT 373 410 9.53e-2 SMART
LRR 433 455 1.45e1 SMART
LRR_TYP 456 479 4.94e-5 SMART
LRR_TYP 480 503 7.78e-3 SMART
LRR_TYP 504 527 2.43e-4 SMART
LRR 528 551 1.86e2 SMART
LRRCT 563 613 3.59e-3 SMART
low complexity region 618 632 N/A INTRINSIC
transmembrane domain 666 688 N/A INTRINSIC
low complexity region 794 816 N/A INTRINSIC
low complexity region 818 823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227891
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.6%
Validation Efficiency 99% (72/73)
MGI Phenotype Strain: 4459459
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the SLITRK family, such as SLITRK5, are integral membrane proteins with 2 N-terminal leucine-rich repeat (LRR) domains similar to those of SLIT proteins (see SLIT1; MIM 603742). Most SLITRKs, including SLITRK5, also have C-terminal regions that share homology with neurotrophin receptors (see NTRK1; MIM 191315). SLITRKs are expressed predominantly in neural tissues and have neurite-modulating activity (Aruga et al., 2003 [PubMed 14557068]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele have abnormal medium spiny neuron morphology and exhibit behavioral abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A G 18: 59,007,493 probably benign Het
Ahnak A G 19: 9,015,002 H4550R possibly damaging Het
Anxa6 A G 11: 54,983,347 V591A probably damaging Het
Apol7c A G 15: 77,526,273 S158P probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
Cacna2d4 A G 6: 119,345,106 probably benign Het
Cd109 T C 9: 78,680,170 probably benign Het
Cep78 C T 19: 15,956,190 V675M probably damaging Het
Ces4a T C 8: 105,144,922 probably benign Het
Chpf A G 1: 75,477,723 V137A probably damaging Het
Comp T C 8: 70,379,101 S457P possibly damaging Het
Cth A G 3: 157,920,115 probably benign Het
Cyp2a12 T C 7: 27,034,138 L314P probably damaging Het
Ets1 C T 9: 32,738,293 R309C probably damaging Het
Fam208b T C 13: 3,574,448 D1834G probably damaging Het
Foxp2 T C 6: 15,254,279 probably benign Het
Gm9875 T G 2: 13,558,184 F108V unknown Het
Golga5 G T 12: 102,476,208 V269F possibly damaging Het
Greb1 T C 12: 16,680,212 Y1738C probably damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Hdac5 A T 11: 102,196,024 V70E probably damaging Het
Hdac9 T C 12: 34,437,222 Q60R probably damaging Het
Hsd17b3 T C 13: 64,073,936 T92A possibly damaging Het
Itpk1 C T 12: 102,606,078 probably benign Het
Lin28a T C 4: 134,008,099 probably benign Het
Mapk6 T C 9: 75,397,962 S58G probably damaging Het
Mmp21 G A 7: 133,677,667 probably benign Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Mroh2a G A 1: 88,250,342 D1053N probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Mto1 T A 9: 78,457,508 I343N probably damaging Het
Mto1 C T 9: 78,470,790 T638M probably damaging Het
Myo18b T C 5: 112,760,327 K2027E possibly damaging Het
Myo7a T C 7: 98,054,338 probably benign Het
Nlrp9a T C 7: 26,557,278 I107T probably damaging Het
Olfr181 C A 16: 58,926,409 R54L possibly damaging Het
Olfr970 T G 9: 39,819,816 M59R possibly damaging Het
Osbpl5 A G 7: 143,705,030 S268P probably damaging Het
Pih1d1 T A 7: 45,159,975 S289T probably benign Het
Pik3c2b A G 1: 133,071,200 D353G probably damaging Het
Ppef2 A G 5: 92,230,509 L609P probably damaging Het
Prune2 A T 19: 17,122,835 D1901V probably damaging Het
Rdh9 T C 10: 127,776,575 Y31H possibly damaging Het
Slc5a9 T A 4: 111,883,871 Y526F possibly damaging Het
Sult1c2 A T 17: 53,831,778 M257K probably damaging Het
Tmem132d A G 5: 127,984,287 I417T possibly damaging Het
Tmem229b T C 12: 78,965,134 T8A probably benign Het
Tmem237 T C 1: 59,114,094 I89M possibly damaging Het
Tnfrsf17 A T 16: 11,319,819 D140V probably damaging Het
Tnrc6b T A 15: 80,923,446 probably benign Het
Trio A G 15: 27,831,399 L194P probably damaging Het
Vmn2r74 T C 7: 85,955,914 probably benign Het
Vps13c T A 9: 67,920,935 M1457K probably benign Het
Zfhx2 A G 14: 55,073,801 C479R possibly damaging Het
Zfp420 T A 7: 29,875,539 C395S probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Zfp82 C T 7: 30,056,329 E443K probably damaging Het
Zranb2 A G 3: 157,541,763 S193G probably benign Het
Other mutations in Slitrk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Slitrk5 APN 14 111680665 missense probably benign 0.05
IGL01624:Slitrk5 APN 14 111681094 missense probably damaging 1.00
IGL01680:Slitrk5 APN 14 111679000 missense probably benign 0.23
IGL03234:Slitrk5 APN 14 111679285 missense probably benign 0.00
P0019:Slitrk5 UTSW 14 111680594 missense possibly damaging 0.88
R0323:Slitrk5 UTSW 14 111681623 missense probably damaging 0.99
R0334:Slitrk5 UTSW 14 111680824 missense probably benign
R0392:Slitrk5 UTSW 14 111679033 missense probably benign 0.06
R1344:Slitrk5 UTSW 14 111680389 missense probably benign 0.04
R1754:Slitrk5 UTSW 14 111680519 missense probably damaging 1.00
R1983:Slitrk5 UTSW 14 111680389 missense probably benign 0.04
R2070:Slitrk5 UTSW 14 111680189 missense probably damaging 0.99
R2071:Slitrk5 UTSW 14 111680189 missense probably damaging 0.99
R3001:Slitrk5 UTSW 14 111679582 missense probably damaging 1.00
R3002:Slitrk5 UTSW 14 111679582 missense probably damaging 1.00
R3003:Slitrk5 UTSW 14 111679582 missense probably damaging 1.00
R3885:Slitrk5 UTSW 14 111679797 nonsense probably null
R3886:Slitrk5 UTSW 14 111679797 nonsense probably null
R3888:Slitrk5 UTSW 14 111679797 nonsense probably null
R4962:Slitrk5 UTSW 14 111681247 missense probably benign 0.02
R4999:Slitrk5 UTSW 14 111680216 missense probably damaging 0.99
R5036:Slitrk5 UTSW 14 111680884 missense possibly damaging 0.87
R5190:Slitrk5 UTSW 14 111679420 missense probably damaging 1.00
R5237:Slitrk5 UTSW 14 111681686 missense possibly damaging 0.94
R5669:Slitrk5 UTSW 14 111681623 missense probably damaging 0.99
R5793:Slitrk5 UTSW 14 111679913 missense probably damaging 1.00
R5839:Slitrk5 UTSW 14 111679598 missense probably benign 0.00
R6083:Slitrk5 UTSW 14 111681725 missense probably benign 0.01
R6224:Slitrk5 UTSW 14 111679816 unclassified probably benign
R6225:Slitrk5 UTSW 14 111679816 unclassified probably benign
R6230:Slitrk5 UTSW 14 111679816 unclassified probably benign
R6337:Slitrk5 UTSW 14 111680252 missense probably damaging 0.96
R6666:Slitrk5 UTSW 14 111680102 missense probably damaging 0.96
R6818:Slitrk5 UTSW 14 111680294 missense probably benign 0.32
R6895:Slitrk5 UTSW 14 111681653 missense probably damaging 1.00
R7094:Slitrk5 UTSW 14 111680836 missense probably benign 0.02
R7385:Slitrk5 UTSW 14 111680699 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TGAACCTGAGGGGTAACAGCTTCAC -3'
(R):5'- GCTGCCACAAAGACGGACATGATG -3'

Sequencing Primer
(F):5'- ACTTCCTTGCCAGTGAGTG -3'
(R):5'- GGGTCCCAGTGCTATTCAAC -3'
Posted On2013-07-30