Incidental Mutation 'R0661:Vmn2r75'
ID61840
Institutional Source Beutler Lab
Gene Symbol Vmn2r75
Ensembl Gene ENSMUSG00000090436
Gene Namevomeronasal 2, receptor 75
SynonymsEG546981
MMRRC Submission 038846-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R0661 (G1)
Quality Score145
Status Not validated
Chromosome7
Chromosomal Location86148042-86171724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86165658 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 209 (A209V)
Ref Sequence ENSEMBL: ENSMUSP00000126973 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167830]
Predicted Effect probably benign
Transcript: ENSMUST00000167830
AA Change: A209V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000126973
Gene: ENSMUSG00000090436
AA Change: A209V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 80 466 2.8e-31 PFAM
Pfam:NCD3G 510 562 4.6e-20 PFAM
Pfam:7tm_3 593 829 7.7e-51 PFAM
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in Vmn2r75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Vmn2r75 APN 7 86148032 unclassified probably benign
IGL01287:Vmn2r75 APN 7 86148593 missense probably damaging 0.97
IGL01318:Vmn2r75 APN 7 86165566 missense probably benign 0.06
IGL01331:Vmn2r75 APN 7 86171662 nonsense probably null
IGL01406:Vmn2r75 APN 7 86163292 splice site probably benign
IGL01615:Vmn2r75 APN 7 86148473 missense probably benign 0.03
IGL01657:Vmn2r75 APN 7 86164247 missense probably damaging 1.00
IGL02237:Vmn2r75 APN 7 86165578 missense possibly damaging 0.88
IGL02275:Vmn2r75 APN 7 86165140 missense probably benign 0.04
IGL02307:Vmn2r75 APN 7 86165766 missense probably benign 0.00
IGL03136:Vmn2r75 APN 7 86148703 missense possibly damaging 0.89
IGL03160:Vmn2r75 APN 7 86148436 missense probably damaging 1.00
IGL03244:Vmn2r75 APN 7 86171725 unclassified probably benign
PIT4449001:Vmn2r75 UTSW 7 86165583 missense probably damaging 1.00
R0049:Vmn2r75 UTSW 7 86148101 nonsense probably null
R0049:Vmn2r75 UTSW 7 86148101 nonsense probably null
R0083:Vmn2r75 UTSW 7 86165658 missense probably benign 0.00
R0108:Vmn2r75 UTSW 7 86165658 missense probably benign 0.00
R0276:Vmn2r75 UTSW 7 86148307 missense probably benign 0.01
R0320:Vmn2r75 UTSW 7 86165080 missense probably benign 0.36
R0471:Vmn2r75 UTSW 7 86165513 missense probably benign 0.01
R0562:Vmn2r75 UTSW 7 86148241 nonsense probably null
R0631:Vmn2r75 UTSW 7 86163270 missense probably null 1.00
R0811:Vmn2r75 UTSW 7 86165367 missense probably benign 0.38
R0812:Vmn2r75 UTSW 7 86165367 missense probably benign 0.38
R0891:Vmn2r75 UTSW 7 86164268 missense possibly damaging 0.81
R1340:Vmn2r75 UTSW 7 86148590 missense probably damaging 0.98
R1501:Vmn2r75 UTSW 7 86165642 missense possibly damaging 0.85
R1760:Vmn2r75 UTSW 7 86148811 missense probably damaging 1.00
R1970:Vmn2r75 UTSW 7 86148262 missense probably damaging 1.00
R2060:Vmn2r75 UTSW 7 86165164 missense probably benign 0.00
R2292:Vmn2r75 UTSW 7 86148936 missense probably damaging 1.00
R3688:Vmn2r75 UTSW 7 86148421 missense probably damaging 0.99
R3892:Vmn2r75 UTSW 7 86164286 missense probably null 1.00
R4532:Vmn2r75 UTSW 7 86148141 nonsense probably null
R4583:Vmn2r75 UTSW 7 86164082 missense possibly damaging 0.81
R4592:Vmn2r75 UTSW 7 86166286 missense probably benign 0.00
R4792:Vmn2r75 UTSW 7 86163170 missense possibly damaging 0.46
R4859:Vmn2r75 UTSW 7 86148403 missense probably benign 0.35
R4896:Vmn2r75 UTSW 7 86171579 missense probably benign 0.01
R4943:Vmn2r75 UTSW 7 86165497 missense probably damaging 1.00
R4992:Vmn2r75 UTSW 7 86166167 critical splice donor site probably null
R5048:Vmn2r75 UTSW 7 86165527 missense possibly damaging 0.66
R5063:Vmn2r75 UTSW 7 86164164 missense probably benign
R5156:Vmn2r75 UTSW 7 86164228 missense possibly damaging 0.51
R5243:Vmn2r75 UTSW 7 86164239 missense probably damaging 1.00
R5277:Vmn2r75 UTSW 7 86166292 missense probably benign
R5574:Vmn2r75 UTSW 7 86166302 missense probably benign 0.22
R5622:Vmn2r75 UTSW 7 86148494 missense probably benign 0.15
R5680:Vmn2r75 UTSW 7 86171571 missense probably benign 0.10
R5884:Vmn2r75 UTSW 7 86165370 missense probably benign
R6021:Vmn2r75 UTSW 7 86171612 missense probably benign 0.01
R6217:Vmn2r75 UTSW 7 86166167 critical splice donor site probably benign
R6242:Vmn2r75 UTSW 7 86165384 missense probably damaging 1.00
R6299:Vmn2r75 UTSW 7 86165274 missense probably benign 0.12
R6441:Vmn2r75 UTSW 7 86171576 missense probably damaging 0.99
R6495:Vmn2r75 UTSW 7 86164079 missense probably benign 0.00
R6553:Vmn2r75 UTSW 7 86164245 missense probably benign 0.28
R6670:Vmn2r75 UTSW 7 86148436 missense probably damaging 1.00
R7078:Vmn2r75 UTSW 7 86166360 missense probably damaging 1.00
R7164:Vmn2r75 UTSW 7 86165384 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCAGATTCTCCAAATGCCTTCAG -3'
(R):5'- GCATTGATACACTTTGCTCAAGCACAC -3'

Sequencing Primer
(F):5'- GGGAGAGTCTTTGTCTCCATAAAC -3'
(R):5'- TGCTCAAGCACACTCTGATG -3'
Posted On2013-07-30