Incidental Mutation 'R0661:Ufsp2'
ID61841
Institutional Source Beutler Lab
Gene Symbol Ufsp2
Ensembl Gene ENSMUSG00000031634
Gene NameUFM1-specific peptidase 2
Synonyms
MMRRC Submission 038846-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0661 (G1)
Quality Score102
Status Not validated
Chromosome8
Chromosomal Location45975528-45996958 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 45979233 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000147971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034051] [ENSMUST00000095323] [ENSMUST00000098786] [ENSMUST00000123307] [ENSMUST00000130412] [ENSMUST00000150943] [ENSMUST00000209443] [ENSMUST00000210081]
Predicted Effect probably null
Transcript: ENSMUST00000034051
AA Change: M1K

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000034051
Gene: ENSMUSG00000031634
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 87 103 N/A INTRINSIC
Pfam:Peptidase_C78 268 453 1.3e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095323
SMART Domains Protein: ENSMUSP00000092961
Gene: ENSMUSG00000071103

DomainStartEndE-ValueType
Pfam:DUF4586 7 297 1.2e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098786
SMART Domains Protein: ENSMUSP00000096383
Gene: ENSMUSG00000071103

DomainStartEndE-ValueType
Pfam:DUF4586 8 294 6.8e-114 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123041
Predicted Effect probably null
Transcript: ENSMUST00000123307
AA Change: M1K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Predicted Effect probably null
Transcript: ENSMUST00000130412
AA Change: M1K

PolyPhen 2 Score 0.917 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably null
Transcript: ENSMUST00000150943
AA Change: M1K

PolyPhen 2 Score 0.614 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably null
Transcript: ENSMUST00000209443
AA Change: M1K
Predicted Effect probably null
Transcript: ENSMUST00000210081
AA Change: M1K

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved cysteine protease. The protein cleaves two C-terminal residues from ubiquitin-fold modifier 1, a ubiquitin-like post-translational modifier protein. Activation of ubiquitin-fold modifier 1 by the encoded protein exposes a C-terminal glycine residue that allows interaction with other proteins and transfer to its target protein. An allelic variant of this gene has been associated with Beukes hip dysplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in Ufsp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02092:Ufsp2 APN 8 45995664 critical splice donor site probably null
IGL02122:Ufsp2 APN 8 45995648 missense probably benign 0.01
IGL02523:Ufsp2 APN 8 45983548 missense probably damaging 1.00
IGL03031:Ufsp2 APN 8 45984100 missense probably damaging 1.00
R0317:Ufsp2 UTSW 8 45992233 critical splice donor site probably null
R0523:Ufsp2 UTSW 8 45996743 missense probably benign 0.00
R0538:Ufsp2 UTSW 8 45992150 missense probably damaging 1.00
R3927:Ufsp2 UTSW 8 45983686 splice site probably null
R4319:Ufsp2 UTSW 8 45995627 missense possibly damaging 0.95
R4355:Ufsp2 UTSW 8 45985465 missense possibly damaging 0.95
R5183:Ufsp2 UTSW 8 45994089 missense probably benign 0.18
R5473:Ufsp2 UTSW 8 45992221 missense probably damaging 1.00
R6726:Ufsp2 UTSW 8 45985467 missense probably benign 0.05
R7133:Ufsp2 UTSW 8 45983624 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTGTTCCAGAGTTAGGAGGCATTG -3'
(R):5'- TGGCATCAGCCTCAGCCAAAAG -3'

Sequencing Primer
(F):5'- CTAAGTGTCCCTAGATGACTTCAG -3'
(R):5'- tgacaattttcttcaagacagcc -3'
Posted On2013-07-30