Incidental Mutation 'R0661:Col1a1'
ID61849
Institutional Source Beutler Lab
Gene Symbol Col1a1
Ensembl Gene ENSMUSG00000001506
Gene Namecollagen, type I, alpha 1
SynonymsCola1, Mov-13, Col1a-1, Cola-1
MMRRC Submission 038846-MU
Accession Numbers

MGI: 88467

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0661 (G1)
Quality Score151
Status Not validated
Chromosome11
Chromosomal Location94936224-94953042 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94949389 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1088 (T1088A)
Ref Sequence ENSEMBL: ENSMUSP00000001547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001547]
Predicted Effect unknown
Transcript: ENSMUST00000001547
AA Change: T1088A
SMART Domains Protein: ENSMUSP00000001547
Gene: ENSMUSG00000001506
AA Change: T1088A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWC 31 86 1.04e-16 SMART
Pfam:Collagen 97 154 1.1e-9 PFAM
Pfam:Collagen 166 227 7e-10 PFAM
Pfam:Collagen 225 284 2.4e-13 PFAM
Pfam:Collagen 285 344 5.9e-12 PFAM
low complexity region 354 426 N/A INTRINSIC
internal_repeat_4 427 444 4.93e-7 PROSPERO
low complexity region 447 486 N/A INTRINSIC
low complexity region 495 516 N/A INTRINSIC
low complexity region 527 567 N/A INTRINSIC
internal_repeat_3 570 588 1.25e-9 PROSPERO
low complexity region 590 600 N/A INTRINSIC
low complexity region 603 627 N/A INTRINSIC
low complexity region 629 651 N/A INTRINSIC
internal_repeat_1 652 675 6.29e-11 PROSPERO
internal_repeat_4 658 675 4.93e-7 PROSPERO
low complexity region 678 699 N/A INTRINSIC
low complexity region 702 717 N/A INTRINSIC
internal_repeat_2 718 738 2.08e-10 PROSPERO
internal_repeat_1 718 741 6.29e-11 PROSPERO
internal_repeat_3 726 744 1.25e-9 PROSPERO
internal_repeat_5 737 752 9.8e-6 PROSPERO
Pfam:Collagen 768 827 2.8e-12 PFAM
Pfam:Collagen 828 887 6.8e-11 PFAM
internal_repeat_5 944 959 9.8e-6 PROSPERO
internal_repeat_2 952 972 2.08e-10 PROSPERO
Pfam:Collagen 1008 1077 4.8e-8 PFAM
Pfam:Collagen 1068 1127 1.2e-12 PFAM
Pfam:Collagen 1122 1184 2.8e-9 PFAM
PDB:3HR2|C 1185 1205 6e-6 PDB
COLFI 1217 1453 2.04e-162 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148046
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of the fibril-forming type I collagen, the most abundant protein of bone, skin and tendon extracellular matrices. The encoded protein, in association with alpha-2 subunit, forms heterotrimeric type I procollagen that undergoes proteolytic processing during fibril formation. Mice lacking the encoded protein die in utero caused by the rupture of a major blood vessel. Transgenic mice expressing significantly lower levels of this gene exhibit morphological and functional defects in mineralized and non-mineralized connective tissue and, progressive loss of hearing. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mutations in this locus cause variable phenotype, from embryonic lethal to viable/fertile with altered fibrillogenesis. Homozygotes can show impaired bone formation and fragility, osteoporosis, dermal fibrosis, impaired uterine postpartum involution, andaortic dissection. [provided by MGI curators]
Allele List at MGI

All alleles(46) : Targeted(40) Gene trapped(3) Transgenic(1) Chemically induced(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in Col1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Col1a1 APN 11 94949378 missense unknown
IGL01383:Col1a1 APN 11 94945525 missense probably damaging 1.00
IGL01717:Col1a1 APN 11 94950777 missense unknown
IGL02889:Col1a1 APN 11 94951509 missense unknown
seal UTSW 11 94947184 splice site probably benign
walrus UTSW 11 94942385 missense unknown
R0121:Col1a1 UTSW 11 94938069 missense unknown
R0400:Col1a1 UTSW 11 94941369 splice site probably benign
R0545:Col1a1 UTSW 11 94951594 missense unknown
R1220:Col1a1 UTSW 11 94951131 missense unknown
R1717:Col1a1 UTSW 11 94948392 missense unknown
R1732:Col1a1 UTSW 11 94944415 splice site probably benign
R1879:Col1a1 UTSW 11 94951225 missense unknown
R1880:Col1a1 UTSW 11 94950568 missense unknown
R1901:Col1a1 UTSW 11 94946632 splice site probably null
R2113:Col1a1 UTSW 11 94948362 missense unknown
R2386:Col1a1 UTSW 11 94950391 missense unknown
R3803:Col1a1 UTSW 11 94938069 missense unknown
R4839:Col1a1 UTSW 11 94950095 critical splice acceptor site probably null
R4936:Col1a1 UTSW 11 94947132 missense unknown
R5081:Col1a1 UTSW 11 94951576 missense unknown
R5105:Col1a1 UTSW 11 94942385 missense unknown
R5110:Col1a1 UTSW 11 94941593 critical splice donor site probably null
R5247:Col1a1 UTSW 11 94947187 splice site probably null
R5773:Col1a1 UTSW 11 94939429 missense probably benign 0.10
R5776:Col1a1 UTSW 11 94949724 missense unknown
R5991:Col1a1 UTSW 11 94937919 missense unknown
R6415:Col1a1 UTSW 11 94940160 missense unknown
R6483:Col1a1 UTSW 11 94942618 splice site probably null
R7207:Col1a1 UTSW 11 94938526 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTGCCCCAGCTTATCCCATGAAG -3'
(R):5'- CTCCCACCATGTGATCTGCATCAG -3'

Sequencing Primer
(F):5'- AGCTTATCCCATGAAGCCTGG -3'
(R):5'- ATGTGATCTGCATCAGGGTATG -3'
Posted On2013-07-30