Incidental Mutation 'R0661:Prdm15'
ID61860
Institutional Source Beutler Lab
Gene Symbol Prdm15
Ensembl Gene ENSMUSG00000014039
Gene NamePR domain containing 15
SynonymsZfp298, E130018M06Rik
MMRRC Submission 038846-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.615) question?
Stock #R0661 (G1)
Quality Score126
Status Not validated
Chromosome16
Chromosomal Location97791467-97851850 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97829682 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 190 (V190E)
Ref Sequence ENSEMBL: ENSMUSP00000113791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095849] [ENSMUST00000121584] [ENSMUST00000142295]
Predicted Effect probably benign
Transcript: ENSMUST00000095849
AA Change: V216E

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000093533
Gene: ENSMUSG00000014039
AA Change: V216E

DomainStartEndE-ValueType
SET 75 191 5.96e-1 SMART
ZnF_C2H2 223 245 3.99e0 SMART
low complexity region 290 303 N/A INTRINSIC
ZnF_C2H2 402 424 3.89e-3 SMART
ZnF_C2H2 434 457 2.75e-3 SMART
ZnF_C2H2 468 488 1.88e2 SMART
ZnF_C2H2 495 517 5.42e-2 SMART
ZnF_C2H2 522 544 1.36e-2 SMART
ZnF_C2H2 571 593 6.23e-2 SMART
ZnF_C2H2 598 620 2.75e-3 SMART
low complexity region 642 657 N/A INTRINSIC
ZnF_C2H2 661 684 2.17e-1 SMART
ZnF_C2H2 689 711 3.24e0 SMART
ZnF_C2H2 725 747 1.38e-3 SMART
ZnF_C2H2 753 775 5.67e-5 SMART
ZnF_C2H2 781 803 3.11e-2 SMART
ZnF_C2H2 809 831 8.34e-3 SMART
ZnF_C2H2 837 859 4.79e-3 SMART
ZnF_C2H2 865 888 4.79e-3 SMART
ZnF_C2H2 894 917 5.06e-2 SMART
low complexity region 948 959 N/A INTRINSIC
low complexity region 1148 1170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121584
AA Change: V190E

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113791
Gene: ENSMUSG00000014039
AA Change: V190E

DomainStartEndE-ValueType
SET 49 165 5.96e-1 SMART
ZnF_C2H2 197 219 3.99e0 SMART
low complexity region 264 277 N/A INTRINSIC
ZnF_C2H2 376 398 3.89e-3 SMART
ZnF_C2H2 408 431 2.75e-3 SMART
ZnF_C2H2 442 462 1.88e2 SMART
ZnF_C2H2 469 491 5.42e-2 SMART
ZnF_C2H2 496 518 1.36e-2 SMART
ZnF_C2H2 545 567 6.23e-2 SMART
ZnF_C2H2 572 594 2.75e-3 SMART
low complexity region 616 631 N/A INTRINSIC
ZnF_C2H2 635 658 2.17e-1 SMART
ZnF_C2H2 663 685 3.24e0 SMART
ZnF_C2H2 699 721 1.38e-3 SMART
ZnF_C2H2 727 749 5.67e-5 SMART
ZnF_C2H2 755 777 3.11e-2 SMART
ZnF_C2H2 783 805 8.34e-3 SMART
ZnF_C2H2 811 833 4.79e-3 SMART
ZnF_C2H2 839 862 4.79e-3 SMART
ZnF_C2H2 868 891 5.06e-2 SMART
low complexity region 922 933 N/A INTRINSIC
low complexity region 1122 1144 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128917
Predicted Effect probably benign
Transcript: ENSMUST00000142295
SMART Domains Protein: ENSMUSP00000120497
Gene: ENSMUSG00000014039

DomainStartEndE-ValueType
SET 49 165 5.96e-1 SMART
low complexity region 230 243 N/A INTRINSIC
ZnF_C2H2 342 364 3.89e-3 SMART
ZnF_C2H2 369 392 2.75e-3 SMART
ZnF_C2H2 403 423 1.88e2 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Rtl5 T C X: 102,070,450 H138R possibly damaging Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Other mutations in Prdm15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Prdm15 APN 16 97806167 splice site probably benign
IGL01325:Prdm15 APN 16 97806517 missense probably damaging 1.00
IGL02195:Prdm15 APN 16 97835829 missense probably damaging 1.00
IGL02473:Prdm15 APN 16 97837605 unclassified probably null
IGL02502:Prdm15 APN 16 97839339 missense probably damaging 1.00
IGL02604:Prdm15 APN 16 97821942 missense probably benign
R0408:Prdm15 UTSW 16 97835786 missense possibly damaging 0.92
R0437:Prdm15 UTSW 16 97812559 missense probably benign 0.00
R0497:Prdm15 UTSW 16 97794334 missense possibly damaging 0.63
R0590:Prdm15 UTSW 16 97797761 missense possibly damaging 0.95
R0630:Prdm15 UTSW 16 97837707 missense probably null 1.00
R0718:Prdm15 UTSW 16 97812633 missense possibly damaging 0.89
R1144:Prdm15 UTSW 16 97808708 missense probably damaging 1.00
R1240:Prdm15 UTSW 16 97837600 missense probably damaging 0.98
R1605:Prdm15 UTSW 16 97839306 missense probably damaging 1.00
R1908:Prdm15 UTSW 16 97837685 missense probably benign 0.27
R2081:Prdm15 UTSW 16 97803780 nonsense probably null
R2208:Prdm15 UTSW 16 97799264 intron probably null
R3787:Prdm15 UTSW 16 97797745 missense probably benign 0.00
R3890:Prdm15 UTSW 16 97799571 missense probably damaging 1.00
R4326:Prdm15 UTSW 16 97806515 missense probably damaging 1.00
R4728:Prdm15 UTSW 16 97821786 missense probably benign 0.04
R4952:Prdm15 UTSW 16 97806077 missense probably damaging 0.99
R4998:Prdm15 UTSW 16 97794489 missense probably damaging 0.97
R5225:Prdm15 UTSW 16 97808675 missense probably damaging 1.00
R5505:Prdm15 UTSW 16 97816983 missense possibly damaging 0.76
R5628:Prdm15 UTSW 16 97799623 missense probably damaging 0.98
R5721:Prdm15 UTSW 16 97807096 missense possibly damaging 0.74
R5873:Prdm15 UTSW 16 97808689 missense probably damaging 1.00
R5980:Prdm15 UTSW 16 97812570 nonsense probably null
R6311:Prdm15 UTSW 16 97799055 missense probably null 0.08
R6540:Prdm15 UTSW 16 97835805 missense probably benign 0.13
R7053:Prdm15 UTSW 16 97794542 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTATGTCCACCATATCCAGAGCC -3'
(R):5'- GTGCATGAGACTGAGGATAGTGCC -3'

Sequencing Primer
(F):5'- agtgaatagcccacatgcc -3'
(R):5'- AGTGCCTAGAATACAGTTGCTC -3'
Posted On2013-07-30