Incidental Mutation 'R0661:Rtl5'
ID61869
Institutional Source Beutler Lab
Gene Symbol Rtl5
Ensembl Gene ENSMUSG00000049191
Gene Nameretrotransposon Gag like 5
SynonymsMar5, 6430402L03Rik, Mart5, Rgag4
MMRRC Submission 038846-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R0661 (G1)
Quality Score217
Status Not validated
ChromosomeX
Chromosomal Location102066544-102071304 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102070450 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 138 (H138R)
Ref Sequence ENSEMBL: ENSMUSP00000139504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101339] [ENSMUST00000113631] [ENSMUST00000119076] [ENSMUST00000124279] [ENSMUST00000144753] [ENSMUST00000188731]
Predicted Effect probably benign
Transcript: ENSMUST00000101339
SMART Domains Protein: ENSMUSP00000098893
Gene: ENSMUSG00000079481

DomainStartEndE-ValueType
low complexity region 48 62 N/A INTRINSIC
low complexity region 68 84 N/A INTRINSIC
low complexity region 135 155 N/A INTRINSIC
Pfam:NHS 494 613 3.8e-11 PFAM
Pfam:NHS 607 771 1.5e-25 PFAM
low complexity region 827 836 N/A INTRINSIC
low complexity region 935 952 N/A INTRINSIC
low complexity region 989 1002 N/A INTRINSIC
low complexity region 1145 1160 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000113631
AA Change: H138R

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109261
Gene: ENSMUSG00000049191
AA Change: H138R

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
low complexity region 120 140 N/A INTRINSIC
Pfam:DUF4939 146 237 4.2e-15 PFAM
Pfam:Retrotrans_gag 195 288 5.8e-13 PFAM
SCOP:d1sig__ 349 492 6e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000119076
AA Change: H138R

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133001
Gene: ENSMUSG00000049191
AA Change: H138R

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
low complexity region 120 140 N/A INTRINSIC
Pfam:Retrotrans_gag 195 288 9.3e-13 PFAM
SCOP:d1sig__ 349 492 6e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124279
SMART Domains Protein: ENSMUSP00000116112
Gene: ENSMUSG00000079481

DomainStartEndE-ValueType
low complexity region 48 62 N/A INTRINSIC
low complexity region 68 94 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139878
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144397
Predicted Effect probably benign
Transcript: ENSMUST00000144753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155477
Predicted Effect possibly damaging
Transcript: ENSMUST00000188731
AA Change: H138R

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139504
Gene: ENSMUSG00000049191
AA Change: H138R

DomainStartEndE-ValueType
coiled coil region 1 39 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
low complexity region 120 140 N/A INTRINSIC
Pfam:Retrotrans_gag 195 288 9.3e-13 PFAM
SCOP:d1sig__ 349 492 6e-3 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agtr1b T A 3: 20,315,999 T148S possibly damaging Het
Anks3 A G 16: 4,948,334 F124L probably damaging Het
Ar T A X: 98,150,565 Y262N probably damaging Het
Asxl1 T A 2: 153,400,724 S1065T possibly damaging Het
BC051142 A T 17: 34,459,913 I217F possibly damaging Het
Brip1 A T 11: 86,110,363 I749N possibly damaging Het
C1ra T A 6: 124,522,377 H507Q probably benign Het
Cdk9 G A 2: 32,709,820 T135I probably damaging Het
Col1a1 A G 11: 94,949,389 T1088A unknown Het
Cpne2 T C 8: 94,556,039 I283T possibly damaging Het
Dcaf17 T C 2: 71,088,435 L451P probably damaging Het
Dhx57 C T 17: 80,268,864 C599Y probably damaging Het
Drd1 T A 13: 54,053,038 N379Y possibly damaging Het
Fsip2 A G 2: 82,986,169 D4082G possibly damaging Het
Grin2a G T 16: 9,992,472 P21Q probably damaging Het
Heyl G T 4: 123,246,031 V128F probably damaging Het
Hoxd12 A G 2: 74,675,892 E216G probably damaging Het
Inpp4b C A 8: 81,741,462 A18E possibly damaging Het
Invs G A 4: 48,421,861 R831H probably benign Het
Lrrk2 T C 15: 91,787,016 V2000A probably damaging Het
Msh3 T C 13: 92,345,096 N303D possibly damaging Het
Olfr1431 T C 19: 12,209,704 L46P probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr743 A G 14: 50,534,095 T228A probably benign Het
Pcdh18 A C 3: 49,753,318 S902R possibly damaging Het
Prdm15 A T 16: 97,829,682 V190E probably benign Het
Ranbp2 T G 10: 58,478,733 S1758R probably benign Het
Rimbp2 A G 5: 128,786,710 V738A probably benign Het
Sec11a A G 7: 80,935,039 V50A probably damaging Het
Shroom1 T C 11: 53,466,937 S772P possibly damaging Het
Slc26a6 T C 9: 108,859,113 probably null Het
Slf1 A G 13: 77,083,596 W555R probably benign Het
Spx A G 6: 142,413,839 S5G possibly damaging Het
Tcp1 T C 17: 12,923,313 V398A probably benign Het
Tm6sf1 G A 7: 81,865,345 probably null Het
Ufsp2 T A 8: 45,979,233 M1K probably null Het
Usf1 G A 1: 171,417,499 R196Q probably damaging Het
Vmn2r75 G A 7: 86,165,658 A209V probably benign Het
Yme1l1 T A 2: 23,191,042 M442K probably damaging Het
Zfand3 A G 17: 30,135,398 E63G probably damaging Het
Zfp740 A G 15: 102,212,659 T136A possibly damaging Het
Predicted Primers PCR Primer
(F):5'- TCCTTCCTGAGTGACTGAGATAGCC -3'
(R):5'- TGCTCAATGAGACTGATCCCACTCC -3'

Sequencing Primer
(F):5'- TCGCTTCCCCTGTGAAAAAGG -3'
(R):5'- CTgaggaggaggaagaggagg -3'
Posted On2013-07-30