Incidental Mutation 'R0662:Cand2'
ID61884
Institutional Source Beutler Lab
Gene Symbol Cand2
Ensembl Gene ENSMUSG00000030319
Gene Namecullin-associated and neddylation-dissociated 2 (putative)
Synonyms2210404G23Rik, Tp120b
MMRRC Submission 038847-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0662 (G1)
Quality Score196
Status Not validated
Chromosome6
Chromosomal Location115774538-115805557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115787210 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 315 (D315G)
Ref Sequence ENSEMBL: ENSMUSP00000075377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075995]
Predicted Effect probably benign
Transcript: ENSMUST00000075995
AA Change: D315G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075377
Gene: ENSMUSG00000030319
AA Change: D315G

DomainStartEndE-ValueType
low complexity region 325 347 N/A INTRINSIC
low complexity region 536 548 N/A INTRINSIC
low complexity region 553 562 N/A INTRINSIC
low complexity region 665 686 N/A INTRINSIC
low complexity region 736 748 N/A INTRINSIC
Pfam:HEAT 861 890 4.4e-5 PFAM
Pfam:TIP120 1044 1209 6e-64 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,920,938 S241P probably benign Het
Ankrd53 G T 6: 83,763,643 V83L probably damaging Het
Armcx2 G A X: 134,805,636 T416I possibly damaging Het
C4b G A 17: 34,730,888 R1441C probably damaging Het
Cacng3 T C 7: 122,768,359 I154T probably damaging Het
Celsr2 A T 3: 108,398,520 S2089R probably damaging Het
Chd9 A C 8: 90,977,676 K247Q probably damaging Het
Chil1 A C 1: 134,188,573 S263R probably damaging Het
Clec12b A C 6: 129,376,237 C262W probably damaging Het
Cpsf7 T C 19: 10,526,008 M1T probably null Het
Cul3 T C 1: 80,271,565 D597G probably damaging Het
Dcaf11 T C 14: 55,565,507 V251A possibly damaging Het
Eno2 A T 6: 124,763,811 F218I probably damaging Het
Frmd6 A T 12: 70,899,444 R549* probably null Het
Fyb2 G A 4: 104,995,698 S461N possibly damaging Het
Gm5709 A T 3: 59,606,743 noncoding transcript Het
Hormad1 T C 3: 95,575,599 I132T probably benign Het
Itga7 G T 10: 128,953,531 R981L probably damaging Het
Itgbl1 T A 14: 123,827,894 N153K probably damaging Het
Itih1 T C 14: 30,933,360 E626G possibly damaging Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,662,349 probably benign Het
Kcna2 A T 3: 107,105,401 T433S probably benign Het
Map4k5 A G 12: 69,813,153 V673A probably damaging Het
Mmp27 T A 9: 7,577,650 V281E probably benign Het
Nr2c1 A T 10: 94,190,738 I492F probably damaging Het
Olfr131 A G 17: 38,082,933 I15T probably benign Het
Olfr292 A G 7: 86,694,630 Y58C possibly damaging Het
Olfr457 C T 6: 42,471,774 V135M possibly damaging Het
Olfr703 A T 7: 106,844,649 I13F probably benign Het
Olfr77 G C 9: 19,920,500 C97S probably damaging Het
Olfr862 T C 9: 19,883,952 M118V probably benign Het
Olfr911-ps1 T A 9: 38,524,026 M98K probably damaging Het
Pank3 T C 11: 35,778,650 M237T probably damaging Het
Plekhh1 A G 12: 79,078,993 T1268A probably benign Het
Ptchd4 A G 17: 42,502,576 Y456C probably damaging Het
Rhcg C T 7: 79,599,729 V310M probably damaging Het
Ryr1 A T 7: 29,100,189 D906E probably damaging Het
Sez6l A T 5: 112,473,422 L262Q probably damaging Het
Shprh G A 10: 11,186,847 V1233I probably damaging Het
Slc3a1 A G 17: 85,037,207 E267G possibly damaging Het
Slc5a5 T A 8: 70,883,875 T616S probably benign Het
St5 G T 7: 109,557,426 P39Q probably damaging Het
Syne3 T G 12: 104,961,510 E318A probably benign Het
Tecpr2 A G 12: 110,896,228 T25A probably benign Het
Ubxn1 T A 19: 8,875,197 probably null Het
Unc5b C A 10: 60,772,583 R616L possibly damaging Het
Ush2a A G 1: 188,351,093 T278A probably benign Het
Utp14b A G 1: 78,664,999 T205A probably damaging Het
Vmn1r219 T C 13: 23,163,453 S271P possibly damaging Het
Vmn2r76 C T 7: 86,230,370 V241M probably benign Het
Zbtb24 G A 10: 41,462,279 G429D probably damaging Het
Zdhhc2 T C 8: 40,447,098 S68P probably damaging Het
Zfp719 G A 7: 43,584,254 M32I possibly damaging Het
Zfp975 T C 7: 42,662,526 N221S probably benign Het
Other mutations in Cand2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01323:Cand2 APN 6 115785125 missense probably benign
IGL01329:Cand2 APN 6 115782794 missense probably benign 0.43
IGL01777:Cand2 APN 6 115792857 missense probably damaging 0.99
IGL02008:Cand2 APN 6 115803638 missense probably damaging 1.00
IGL02185:Cand2 APN 6 115789510 missense probably benign 0.01
IGL02219:Cand2 APN 6 115803812 missense probably damaging 1.00
IGL02240:Cand2 APN 6 115803662 missense probably damaging 1.00
IGL02329:Cand2 APN 6 115789607 missense probably damaging 1.00
IGL02396:Cand2 APN 6 115791188 splice site probably benign
IGL02893:Cand2 APN 6 115791960 missense probably damaging 1.00
IGL03161:Cand2 APN 6 115792737 missense probably benign 0.45
IGL03170:Cand2 APN 6 115797900 missense probably damaging 1.00
IGL03257:Cand2 APN 6 115799983 missense possibly damaging 0.80
succor UTSW 6 115791192 missense probably damaging 1.00
R0196:Cand2 UTSW 6 115789502 missense probably damaging 1.00
R0390:Cand2 UTSW 6 115774653 missense possibly damaging 0.90
R0534:Cand2 UTSW 6 115787236 missense probably damaging 0.96
R0630:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0631:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0671:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0708:Cand2 UTSW 6 115803805 missense probably damaging 1.00
R0849:Cand2 UTSW 6 115792391 missense probably damaging 1.00
R1992:Cand2 UTSW 6 115785132 missense possibly damaging 0.88
R3428:Cand2 UTSW 6 115789707 missense probably benign
R3773:Cand2 UTSW 6 115785217 missense probably damaging 0.96
R4329:Cand2 UTSW 6 115799988 missense possibly damaging 0.64
R4489:Cand2 UTSW 6 115789466 missense probably damaging 1.00
R4553:Cand2 UTSW 6 115792211 missense probably damaging 1.00
R4577:Cand2 UTSW 6 115791259 missense probably damaging 1.00
R4634:Cand2 UTSW 6 115797987 missense probably damaging 1.00
R4850:Cand2 UTSW 6 115801948 missense probably benign 0.14
R5155:Cand2 UTSW 6 115792258 missense probably benign 0.42
R5190:Cand2 UTSW 6 115789513 missense probably damaging 1.00
R5378:Cand2 UTSW 6 115801951 missense probably benign 0.00
R5407:Cand2 UTSW 6 115785200 missense possibly damaging 0.76
R5698:Cand2 UTSW 6 115791743 missense probably damaging 1.00
R5701:Cand2 UTSW 6 115797932 missense probably damaging 0.99
R6172:Cand2 UTSW 6 115791310 missense probably benign 0.00
R6763:Cand2 UTSW 6 115799969 missense probably benign 0.00
R6920:Cand2 UTSW 6 115791289 missense possibly damaging 0.93
R7229:Cand2 UTSW 6 115791192 missense probably damaging 1.00
R7520:Cand2 UTSW 6 115785251 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACGATGAGCTAAGAGAGTCCTGCC -3'
(R):5'- TGCCTTCCCTACAGCTAGAGAAGAG -3'

Sequencing Primer
(F):5'- CCTTCCTAAGAAAGTAAGTGTGGC -3'
(R):5'- CTACAGCTAGAGAAGAGCAGCATC -3'
Posted On2013-07-30