Incidental Mutation 'R0662:Vmn2r76'
ID61892
Institutional Source Beutler Lab
Gene Symbol Vmn2r76
Ensembl Gene ENSMUSG00000091239
Gene Namevomeronasal 2, receptor 76
Synonyms
MMRRC Submission 038847-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.301) question?
Stock #R0662 (G1)
Quality Score109
Status Not validated
Chromosome7
Chromosomal Location86225206-86246201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 86230370 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 241 (V241M)
Ref Sequence ENSEMBL: ENSMUSP00000127309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165771]
Predicted Effect probably benign
Transcript: ENSMUST00000165771
AA Change: V241M

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127309
Gene: ENSMUSG00000091239
AA Change: V241M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 470 1.2e-29 PFAM
low complexity region 476 489 N/A INTRINSIC
Pfam:NCD3G 513 565 3.7e-22 PFAM
Pfam:7tm_3 598 833 1.4e-52 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf T C 19: 31,920,938 S241P probably benign Het
Ankrd53 G T 6: 83,763,643 V83L probably damaging Het
Armcx2 G A X: 134,805,636 T416I possibly damaging Het
C4b G A 17: 34,730,888 R1441C probably damaging Het
Cacng3 T C 7: 122,768,359 I154T probably damaging Het
Cand2 A G 6: 115,787,210 D315G probably benign Het
Celsr2 A T 3: 108,398,520 S2089R probably damaging Het
Chd9 A C 8: 90,977,676 K247Q probably damaging Het
Chil1 A C 1: 134,188,573 S263R probably damaging Het
Clec12b A C 6: 129,376,237 C262W probably damaging Het
Cpsf7 T C 19: 10,526,008 M1T probably null Het
Cul3 T C 1: 80,271,565 D597G probably damaging Het
Dcaf11 T C 14: 55,565,507 V251A possibly damaging Het
Eno2 A T 6: 124,763,811 F218I probably damaging Het
Frmd6 A T 12: 70,899,444 R549* probably null Het
Fyb2 G A 4: 104,995,698 S461N possibly damaging Het
Gm5709 A T 3: 59,606,743 noncoding transcript Het
Hormad1 T C 3: 95,575,599 I132T probably benign Het
Itga7 G T 10: 128,953,531 R981L probably damaging Het
Itgbl1 T A 14: 123,827,894 N153K probably damaging Het
Itih1 T C 14: 30,933,360 E626G possibly damaging Het
Kat6b AGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGA 14: 21,662,349 probably benign Het
Kcna2 A T 3: 107,105,401 T433S probably benign Het
Map4k5 A G 12: 69,813,153 V673A probably damaging Het
Mmp27 T A 9: 7,577,650 V281E probably benign Het
Nr2c1 A T 10: 94,190,738 I492F probably damaging Het
Olfr131 A G 17: 38,082,933 I15T probably benign Het
Olfr292 A G 7: 86,694,630 Y58C possibly damaging Het
Olfr457 C T 6: 42,471,774 V135M possibly damaging Het
Olfr703 A T 7: 106,844,649 I13F probably benign Het
Olfr77 G C 9: 19,920,500 C97S probably damaging Het
Olfr862 T C 9: 19,883,952 M118V probably benign Het
Olfr911-ps1 T A 9: 38,524,026 M98K probably damaging Het
Pank3 T C 11: 35,778,650 M237T probably damaging Het
Plekhh1 A G 12: 79,078,993 T1268A probably benign Het
Ptchd4 A G 17: 42,502,576 Y456C probably damaging Het
Rhcg C T 7: 79,599,729 V310M probably damaging Het
Ryr1 A T 7: 29,100,189 D906E probably damaging Het
Sez6l A T 5: 112,473,422 L262Q probably damaging Het
Shprh G A 10: 11,186,847 V1233I probably damaging Het
Slc3a1 A G 17: 85,037,207 E267G possibly damaging Het
Slc5a5 T A 8: 70,883,875 T616S probably benign Het
St5 G T 7: 109,557,426 P39Q probably damaging Het
Syne3 T G 12: 104,961,510 E318A probably benign Het
Tecpr2 A G 12: 110,896,228 T25A probably benign Het
Ubxn1 T A 19: 8,875,197 probably null Het
Unc5b C A 10: 60,772,583 R616L possibly damaging Het
Ush2a A G 1: 188,351,093 T278A probably benign Het
Utp14b A G 1: 78,664,999 T205A probably damaging Het
Vmn1r219 T C 13: 23,163,453 S271P possibly damaging Het
Zbtb24 G A 10: 41,462,279 G429D probably damaging Het
Zdhhc2 T C 8: 40,447,098 S68P probably damaging Het
Zfp719 G A 7: 43,584,254 M32I possibly damaging Het
Zfp975 T C 7: 42,662,526 N221S probably benign Het
Other mutations in Vmn2r76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Vmn2r76 APN 7 86228717 missense probably benign
IGL01374:Vmn2r76 APN 7 86225649 missense probably benign 0.02
IGL01419:Vmn2r76 APN 7 86225702 missense probably benign 0.32
IGL01627:Vmn2r76 APN 7 86225663 missense probably damaging 1.00
IGL01730:Vmn2r76 APN 7 86230198 missense probably benign 0.02
IGL01957:Vmn2r76 APN 7 86228717 missense probably benign
IGL02214:Vmn2r76 APN 7 86229930 missense probably benign 0.07
IGL02489:Vmn2r76 APN 7 86228863 missense probably benign 0.41
IGL02543:Vmn2r76 APN 7 86230148 missense probably benign 0.06
IGL02579:Vmn2r76 APN 7 86228753 nonsense probably null
IGL02598:Vmn2r76 APN 7 86228671 missense probably benign 0.05
IGL02720:Vmn2r76 APN 7 86225706 missense probably benign 0.35
IGL02745:Vmn2r76 APN 7 86230287 missense probably benign 0.06
IGL03393:Vmn2r76 APN 7 86229826 missense probably benign 0.01
R0483:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R0513:Vmn2r76 UTSW 7 86228779 missense probably benign 0.01
R0528:Vmn2r76 UTSW 7 86230298 missense possibly damaging 0.80
R0601:Vmn2r76 UTSW 7 86226115 critical splice acceptor site probably null
R0883:Vmn2r76 UTSW 7 86228696 missense probably benign 0.00
R1532:Vmn2r76 UTSW 7 86230246 missense probably benign 0.02
R1694:Vmn2r76 UTSW 7 86230148 missense probably benign 0.06
R1696:Vmn2r76 UTSW 7 86231256 missense possibly damaging 0.56
R2135:Vmn2r76 UTSW 7 86231011 missense probably benign 0.02
R2151:Vmn2r76 UTSW 7 86230484 missense probably benign
R2181:Vmn2r76 UTSW 7 86225535 missense probably benign 0.00
R2268:Vmn2r76 UTSW 7 86230499 missense probably benign 0.03
R2877:Vmn2r76 UTSW 7 86225993 missense probably benign 0.00
R3155:Vmn2r76 UTSW 7 86225751 missense probably damaging 1.00
R3746:Vmn2r76 UTSW 7 86225555 missense probably benign 0.11
R3799:Vmn2r76 UTSW 7 86226036 missense probably benign 0.00
R3825:Vmn2r76 UTSW 7 86231207 missense probably benign 0.10
R4058:Vmn2r76 UTSW 7 86230300 missense probably benign 0.00
R4237:Vmn2r76 UTSW 7 86230532 missense probably benign 0.00
R4404:Vmn2r76 UTSW 7 86228303 missense probably benign 0.16
R4796:Vmn2r76 UTSW 7 86230444 missense possibly damaging 0.95
R4838:Vmn2r76 UTSW 7 86225525 missense probably damaging 1.00
R5175:Vmn2r76 UTSW 7 86228707 missense probably benign 0.00
R5268:Vmn2r76 UTSW 7 86226059 missense probably damaging 1.00
R5381:Vmn2r76 UTSW 7 86225288 missense probably damaging 1.00
R5531:Vmn2r76 UTSW 7 86225449 missense probably damaging 1.00
R5566:Vmn2r76 UTSW 7 86226078 missense probably damaging 1.00
R5646:Vmn2r76 UTSW 7 86226053 missense probably damaging 0.98
R5664:Vmn2r76 UTSW 7 86245994 critical splice donor site probably null
R5818:Vmn2r76 UTSW 7 86229934 missense probably benign 0.00
R6093:Vmn2r76 UTSW 7 86228261 nonsense probably null
R6651:Vmn2r76 UTSW 7 86228851 missense possibly damaging 0.64
R6741:Vmn2r76 UTSW 7 86230352 missense probably benign
R6750:Vmn2r76 UTSW 7 86225906 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATATCCCACTGTGAGGTAGTAACCC -3'
(R):5'- GCTTTAGCAGATTGGAAGGCAGAGTC -3'

Sequencing Primer
(F):5'- CACTGTGAGGTAGTAACCCAGATTC -3'
(R):5'- AATGTCCTACAGCTTTACTATGGC -3'
Posted On2013-07-30