Incidental Mutation 'R0664:4921517D22Rik'
List |< first << previous [record 7 of 1259] next >> last >|
ID61952
Institutional Source Beutler Lab
Gene Symbol 4921517D22Rik
Ensembl Gene ENSMUSG00000049902
Gene NameRIKEN cDNA 4921517D22 gene
Synonyms
MMRRC Submission 038849-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0664 (G1)
Quality Score100
Status Validated
Chromosome13
Chromosomal Location59687402-59694108 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCC to GC at 59691598 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153380 (fasta)
Gene Model
Predicted Effect probably null
Transcript: ENSMUST00000061597
Predicted Effect probably null
Transcript: ENSMUST00000225373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225788
Meta Mutation Damage Score 0.6464 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik T C 17: 48,166,591 I53V probably benign Het
Agmo A T 12: 37,252,572 H136L probably damaging Het
B020004C17Rik G A 14: 57,016,768 R116H possibly damaging Het
Btbd11 G A 10: 85,388,370 A348T possibly damaging Het
Cacna1b A G 2: 24,654,446 S1243P probably damaging Het
Champ1 G A 8: 13,879,485 V548M probably damaging Het
Dnah7b A T 1: 46,324,842 M3541L probably damaging Het
Emc9 A G 14: 55,581,908 L138P possibly damaging Het
Epcam T A 17: 87,639,970 Y51N possibly damaging Het
Gpr55 A T 1: 85,941,017 S281T probably benign Het
Grid2ip T A 5: 143,363,977 probably null Het
Hgfac G T 5: 35,048,178 V601F probably benign Het
Hlcs A G 16: 94,231,311 W545R probably damaging Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Ipo8 A T 6: 148,800,213 L466I probably benign Het
Jcad A G 18: 4,676,063 D1275G probably damaging Het
Mdn1 G T 4: 32,768,011 E5315* probably null Het
Nfam1 T C 15: 83,014,938 T176A probably damaging Het
Nsd3 T C 8: 25,714,240 F432S probably damaging Het
Olfr1183 C T 2: 88,462,171 P296L probably damaging Het
Prmt5 G T 14: 54,507,856 T618K probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Serpinb7 A G 1: 107,428,307 D20G probably damaging Het
Slco1a4 T C 6: 141,812,741 I515V probably benign Het
Stk26 T A X: 50,887,926 Y283* probably null Het
Tanc1 A T 2: 59,843,884 K1778* probably null Het
Thada A G 17: 84,336,829 L1288P probably damaging Het
Ttbk2 C A 2: 120,748,821 V607F probably damaging Het
Other mutations in 4921517D22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:4921517D22Rik APN 13 59689476 missense probably benign 0.00
IGL01516:4921517D22Rik APN 13 59690734 missense probably benign 0.00
R0395:4921517D22Rik UTSW 13 59689656 missense possibly damaging 0.94
R0579:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0757:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0758:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0777:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0779:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0814:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0870:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0872:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0873:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1062:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1064:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1149:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1149:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1151:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1152:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1207:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1207:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1285:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1339:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1358:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1359:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1360:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1361:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1679:4921517D22Rik UTSW 13 59691598 frame shift probably null
R4703:4921517D22Rik UTSW 13 59689528 missense possibly damaging 0.94
R4785:4921517D22Rik UTSW 13 59691592 missense probably benign
R4823:4921517D22Rik UTSW 13 59690904 missense probably damaging 0.99
R5054:4921517D22Rik UTSW 13 59689501 missense probably damaging 0.97
R6144:4921517D22Rik UTSW 13 59689533 missense probably damaging 0.99
R6977:4921517D22Rik UTSW 13 59691580 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ACTGAAATGAAACTCCGGTGCCC -3'
(R):5'- TCACCAATGAAATGGTCAGAGCTGC -3'

Sequencing Primer
(F):5'- TCGCCTGCATGTGGTATCAT -3'
(R):5'- GCTACTTGAAACATGATTGACTCGAC -3'
Posted On2013-07-30