Incidental Mutation 'R0664:Jcad'
ID61959
Institutional Source Beutler Lab
Gene Symbol Jcad
Ensembl Gene ENSMUSG00000033960
Gene Namejunctional cadherin 5 associated
Synonyms9430020K01Rik
MMRRC Submission 038849-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0664 (G1)
Quality Score149
Status Validated
Chromosome18
Chromosomal Location4634929-4682868 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4676063 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1275 (D1275G)
Ref Sequence ENSEMBL: ENSMUSP00000038613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037029]
Predicted Effect probably damaging
Transcript: ENSMUST00000037029
AA Change: D1275G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038613
Gene: ENSMUSG00000033960
AA Change: D1275G

DomainStartEndE-ValueType
Pfam:JCAD 1 1309 N/A PFAM
Meta Mutation Damage Score 0.016 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 98% (40/41)
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921517D22Rik GCC GC 13: 59,691,598 probably null Het
A530064D06Rik T C 17: 48,166,591 I53V probably benign Het
Agmo A T 12: 37,252,572 H136L probably damaging Het
B020004C17Rik G A 14: 57,016,768 R116H possibly damaging Het
Btbd11 G A 10: 85,388,370 A348T possibly damaging Het
Cacna1b A G 2: 24,654,446 S1243P probably damaging Het
Champ1 G A 8: 13,879,485 V548M probably damaging Het
Dnah7b A T 1: 46,324,842 M3541L probably damaging Het
Emc9 A G 14: 55,581,908 L138P possibly damaging Het
Epcam T A 17: 87,639,970 Y51N possibly damaging Het
Gpr55 A T 1: 85,941,017 S281T probably benign Het
Grid2ip T A 5: 143,363,977 probably null Het
Hgfac G T 5: 35,048,178 V601F probably benign Het
Hlcs A G 16: 94,231,311 W545R probably damaging Het
Hsd17b2 T C 8: 117,758,701 V301A possibly damaging Het
Ipo8 A T 6: 148,800,213 L466I probably benign Het
Mdn1 G T 4: 32,768,011 E5315* probably null Het
Nfam1 T C 15: 83,014,938 T176A probably damaging Het
Nsd3 T C 8: 25,714,240 F432S probably damaging Het
Olfr1183 C T 2: 88,462,171 P296L probably damaging Het
Prmt5 G T 14: 54,507,856 T618K probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Serpinb7 A G 1: 107,428,307 D20G probably damaging Het
Slco1a4 T C 6: 141,812,741 I515V probably benign Het
Stk26 T A X: 50,887,926 Y283* probably null Het
Tanc1 A T 2: 59,843,884 K1778* probably null Het
Thada A G 17: 84,336,829 L1288P probably damaging Het
Ttbk2 C A 2: 120,748,821 V607F probably damaging Het
Other mutations in Jcad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Jcad APN 18 4675692 missense probably benign 0.14
IGL00672:Jcad APN 18 4674835 missense possibly damaging 0.77
IGL00782:Jcad APN 18 4675073 missense probably benign 0.00
IGL00825:Jcad APN 18 4673516 missense probably damaging 1.00
IGL01522:Jcad APN 18 4673312 missense probably damaging 0.97
IGL01796:Jcad APN 18 4672855 nonsense probably null
IGL01973:Jcad APN 18 4675514 missense probably benign 0.21
IGL02083:Jcad APN 18 4680266 utr 3 prime probably benign
IGL02625:Jcad APN 18 4674422 missense probably benign 0.03
IGL03002:Jcad APN 18 4675153 missense probably benign 0.00
IGL03325:Jcad APN 18 4673902 missense probably benign
R0304:Jcad UTSW 18 4673325 missense possibly damaging 0.75
R0487:Jcad UTSW 18 4673243 missense probably damaging 1.00
R0519:Jcad UTSW 18 4649122 start gained probably benign
R1649:Jcad UTSW 18 4673309 missense probably damaging 1.00
R1710:Jcad UTSW 18 4674511 missense probably damaging 1.00
R1734:Jcad UTSW 18 4674526 missense probably damaging 1.00
R1823:Jcad UTSW 18 4675780 missense probably damaging 1.00
R1824:Jcad UTSW 18 4649293 missense probably benign
R1850:Jcad UTSW 18 4675730 missense possibly damaging 0.95
R1872:Jcad UTSW 18 4673048 missense probably benign
R1878:Jcad UTSW 18 4673857 missense possibly damaging 0.60
R1918:Jcad UTSW 18 4674292 missense probably damaging 1.00
R1967:Jcad UTSW 18 4675162 missense probably benign 0.07
R2420:Jcad UTSW 18 4675952 missense probably damaging 1.00
R2504:Jcad UTSW 18 4674026 missense probably damaging 0.99
R2936:Jcad UTSW 18 4675153 missense probably benign 0.00
R4420:Jcad UTSW 18 4676032 missense probably benign 0.00
R4668:Jcad UTSW 18 4680221 splice site probably null
R4670:Jcad UTSW 18 4674175 missense probably benign 0.03
R4671:Jcad UTSW 18 4674175 missense probably benign 0.03
R4707:Jcad UTSW 18 4649338 nonsense probably null
R4720:Jcad UTSW 18 4674055 missense probably benign 0.03
R4815:Jcad UTSW 18 4675223 missense possibly damaging 0.94
R4906:Jcad UTSW 18 4673762 missense probably damaging 1.00
R5214:Jcad UTSW 18 4674134 missense probably damaging 1.00
R5439:Jcad UTSW 18 4675790 missense probably damaging 1.00
R5563:Jcad UTSW 18 4673944 missense possibly damaging 0.93
R5721:Jcad UTSW 18 4676044 missense possibly damaging 0.48
R5825:Jcad UTSW 18 4674896 missense probably benign 0.00
R5952:Jcad UTSW 18 4674554 missense probably damaging 1.00
R6661:Jcad UTSW 18 4675256 missense probably damaging 1.00
R6928:Jcad UTSW 18 4673372 missense probably benign 0.00
T0722:Jcad UTSW 18 4675531 missense probably benign 0.25
X0017:Jcad UTSW 18 4676044 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGCTCAGAAACCCTTCCAAAGTG -3'
(R):5'- AACTTGCCCAGCAAATGCCCTG -3'

Sequencing Primer
(F):5'- ACCCTTCCAAAGTGGTTGAG -3'
(R):5'- gccttcaagttcttcctgtgtc -3'
Posted On2013-07-30