Mutagenetix > Incidental Mutation

Incidental Mutation 'R0665:Smarca4'

61987

Institutional Source

Beutler Lab

Gene Symbol

Smarca4

Ensembl Gene

ENSMUSG00000032187

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4

Synonyms

SW1/SNF, Brg1, SNF2beta, b2b692Clo, b2b508.1Clo

MMRRC Submission

038850-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0665 (G1)

Quality Score

144

Status

Not validated

Chromosome

Chromosomal Location

21527465-21615526 bp(+) (GRCm39)

Type of Mutation

small deletion (1 aa in frame mutation)

DNA Base Change (assembly)

CGAGGAGGAGGAGGAGG to CGAGGAGGAGGAGG at 21612239 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000133922 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034707] [ENSMUST00000098948] [ENSMUST00000174008]

AlphaFold

Q3TKT4

Predicted Effect

probably benign
Transcript: ENSMUST00000034707

SMART Domains

Protein: ENSMUSP00000034707
Gene: ENSMUSG00000032187

Domain	Start	End	E-Value	Type
low complexity region	6	58	N/A	INTRINSIC
low complexity region	130	153	N/A	INTRINSIC
QLQ	170	206	3.98e-14	SMART
low complexity region	221	247	N/A	INTRINSIC
low complexity region	252	289	N/A	INTRINSIC
low complexity region	304	330	N/A	INTRINSIC
low complexity region	407	418	N/A	INTRINSIC
HSA	460	532	2e-27	SMART
coiled coil region	563	595	N/A	INTRINSIC
BRK	612	656	5.17e-21	SMART
low complexity region	657	672	N/A	INTRINSIC
low complexity region	691	702	N/A	INTRINSIC
DEXDc	750	942	5.17e-38	SMART
Blast:DEXDc	953	985	7e-10	BLAST
low complexity region	1019	1034	N/A	INTRINSIC
HELICc	1110	1194	7.27e-24	SMART
low complexity region	1252	1267	N/A	INTRINSIC
SnAC	1288	1356	2.8e-29	SMART
low complexity region	1360	1385	N/A	INTRINSIC
low complexity region	1388	1398	N/A	INTRINSIC
BROMO	1422	1533	4.19e-42	SMART
low complexity region	1534	1557	N/A	INTRINSIC
low complexity region	1578	1588	N/A	INTRINSIC
low complexity region	1594	1614	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000098948

SMART Domains

Protein: ENSMUSP00000096547
Gene: ENSMUSG00000032187

Domain	Start	End	E-Value	Type
low complexity region	6	58	N/A	INTRINSIC
low complexity region	130	153	N/A	INTRINSIC
QLQ	170	206	3.98e-14	SMART
low complexity region	221	247	N/A	INTRINSIC
low complexity region	252	289	N/A	INTRINSIC
low complexity region	304	330	N/A	INTRINSIC
low complexity region	407	418	N/A	INTRINSIC
HSA	460	532	2e-27	SMART
coiled coil region	563	595	N/A	INTRINSIC
BRK	612	656	5.17e-21	SMART
low complexity region	657	672	N/A	INTRINSIC
low complexity region	691	702	N/A	INTRINSIC
DEXDc	750	942	5.17e-38	SMART
Blast:DEXDc	953	985	7e-10	BLAST
low complexity region	1019	1034	N/A	INTRINSIC
HELICc	1110	1194	7.27e-24	SMART
low complexity region	1252	1267	N/A	INTRINSIC
SnAC	1288	1356	2.8e-29	SMART
low complexity region	1363	1388	N/A	INTRINSIC
low complexity region	1391	1401	N/A	INTRINSIC
BROMO	1425	1536	4.19e-42	SMART
low complexity region	1537	1560	N/A	INTRINSIC
low complexity region	1581	1591	N/A	INTRINSIC
low complexity region	1597	1617	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174008

SMART Domains

Protein: ENSMUSP00000133922
Gene: ENSMUSG00000032187

Domain	Start	End	E-Value	Type
low complexity region	6	58	N/A	INTRINSIC
low complexity region	130	153	N/A	INTRINSIC
QLQ	170	206	3.98e-14	SMART
low complexity region	221	247	N/A	INTRINSIC
low complexity region	252	289	N/A	INTRINSIC
low complexity region	304	330	N/A	INTRINSIC
low complexity region	407	418	N/A	INTRINSIC
HSA	460	532	2e-27	SMART
coiled coil region	563	595	N/A	INTRINSIC
BRK	612	656	5.17e-21	SMART
low complexity region	657	672	N/A	INTRINSIC
low complexity region	691	702	N/A	INTRINSIC
DEXDc	750	942	5.17e-38	SMART
Blast:DEXDc	953	985	7e-10	BLAST
low complexity region	1019	1034	N/A	INTRINSIC
HELICc	1110	1194	7.27e-24	SMART
low complexity region	1252	1267	N/A	INTRINSIC
SnAC	1288	1356	2.8e-29	SMART
low complexity region	1360	1385	N/A	INTRINSIC
low complexity region	1388	1398	N/A	INTRINSIC
BROMO	1422	1532	1.36e-41	SMART
low complexity region	1533	1556	N/A	INTRINSIC
low complexity region	1577	1587	N/A	INTRINSIC
low complexity region	1593	1613	N/A	INTRINSIC

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.5%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins and is similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. In addition, this protein can bind BRCA1, as well as regulate the expression of the tumorigenic protein CD44. Mutations in this gene cause rhabdoid tumor predisposition syndrome type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a null allele die in utero before implantation. Embryos heterozygous for this null allele and an ENU-induced allele show impaired definitive erythropoiesis, anemia and lethality during organogenesis. Heterozygotes for a different null allele show cyanosis and cardiovascular defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 28 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Agbl2	A	G	2: 90,631,554 (GRCm39)	Y304C	probably damaging	Het
B3galt2	T	C	1: 143,522,191 (GRCm39)	V109A	possibly damaging	Het
Chml	T	A	1: 175,515,461 (GRCm39)	E153D	probably benign	Het
Dap3	A	T	3: 88,838,304 (GRCm39)	C78*	probably null	Het
Dnah8	T	C	17: 30,955,129 (GRCm39)	F2053L	probably damaging	Het
Dppa3	A	G	6: 122,606,939 (GRCm39)	E143G	probably damaging	Het
Espnl	T	G	1: 91,262,409 (GRCm39)		probably null	Het
Fat3	C	T	9: 15,908,698 (GRCm39)	A2435T	probably benign	Het
Flnc	G	A	6: 29,455,530 (GRCm39)	V2027M	probably damaging	Het
Gtf2h2	C	T	13: 100,617,562 (GRCm39)	G200E	probably damaging	Het
Gtpbp1	A	G	15: 79,597,648 (GRCm39)	I348V	probably benign	Het
Kansl1	A	G	11: 104,234,364 (GRCm39)	V714A	probably benign	Het
Kcnk10	T	C	12: 98,406,944 (GRCm39)	I251V	probably benign	Het
Kri1	G	A	9: 21,192,936 (GRCm39)		probably benign	Het
Lcmt1	G	A	7: 123,002,094 (GRCm39)	D120N	probably damaging	Het
Myom3	A	G	4: 135,492,237 (GRCm39)	D127G	possibly damaging	Het
Or12e1	A	G	2: 87,022,652 (GRCm39)	Y207C	probably damaging	Het
Or1j4	T	C	2: 36,740,202 (GRCm39)	L48P	probably damaging	Het
Or5w13	C	T	2: 87,524,152 (GRCm39)	V25I	probably benign	Het
Phyhd1	A	G	2: 30,171,040 (GRCm39)	H241R	probably damaging	Het
Ppp2r5d	A	T	17: 46,997,330 (GRCm39)	N287K	probably damaging	Het
Ralgds	A	G	2: 28,435,218 (GRCm39)	H458R	probably damaging	Het
Scn3a	C	A	2: 65,314,755 (GRCm39)	R1102L	probably null	Het
Sdhc	T	C	1: 170,963,626 (GRCm39)	Y80C	probably damaging	Het
Tgfbr3	A	T	5: 107,325,716 (GRCm39)	H115Q	probably benign	Het
Triobp	T	C	15: 78,858,098 (GRCm39)	L1233P	possibly damaging	Het
Trpc6	A	C	9: 8,634,123 (GRCm39)	T401P	probably benign	Het
Ttc5	T	A	14: 51,003,415 (GRCm39)	Q423L	probably benign	Het

Other mutations in Smarca4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01380:Smarca4	APN	9	21,590,369 (GRCm39)	missense	probably benign	0.30
IGL01694:Smarca4	APN	9	21,577,166 (GRCm39)	missense	probably damaging	1.00
IGL02147:Smarca4	APN	9	21,546,999 (GRCm39)	missense	probably damaging	0.98
IGL02417:Smarca4	APN	9	21,612,386 (GRCm39)	missense	probably damaging	1.00
IGL02421:Smarca4	APN	9	21,550,535 (GRCm39)	missense	probably damaging	1.00
IGL02550:Smarca4	APN	9	21,597,418 (GRCm39)	missense	probably benign	0.25
IGL02794:Smarca4	APN	9	21,584,638 (GRCm39)	splice site	probably benign
IGL03030:Smarca4	APN	9	21,547,132 (GRCm39)	missense	probably benign	0.14
IGL03037:Smarca4	APN	9	21,544,231 (GRCm39)	unclassified	probably benign
IGL03069:Smarca4	APN	9	21,547,132 (GRCm39)	missense	probably benign	0.14
IGL03355:Smarca4	APN	9	21,547,132 (GRCm39)	missense	probably benign	0.14
R0123:Smarca4	UTSW	9	21,548,620 (GRCm39)	missense	probably damaging	1.00
R0134:Smarca4	UTSW	9	21,548,620 (GRCm39)	missense	probably damaging	1.00
R0230:Smarca4	UTSW	9	21,612,168 (GRCm39)	missense	probably damaging	0.99
R0269:Smarca4	UTSW	9	21,547,497 (GRCm39)	missense	probably benign	0.09
R0631:Smarca4	UTSW	9	21,570,280 (GRCm39)	splice site	probably benign
R0726:Smarca4	UTSW	9	21,611,435 (GRCm39)	critical splice donor site	probably null
R0801:Smarca4	UTSW	9	21,553,850 (GRCm39)	missense	possibly damaging	0.81
R0918:Smarca4	UTSW	9	21,547,511 (GRCm39)	missense	probably benign	0.16
R1411:Smarca4	UTSW	9	21,570,251 (GRCm39)	missense	probably damaging	1.00
R1604:Smarca4	UTSW	9	21,612,239 (GRCm39)	small deletion	probably benign
R1768:Smarca4	UTSW	9	21,612,479 (GRCm39)	missense	possibly damaging	0.56
R2004:Smarca4	UTSW	9	21,588,776 (GRCm39)	missense	probably damaging	1.00
R2031:Smarca4	UTSW	9	21,597,358 (GRCm39)	missense	possibly damaging	0.68
R2211:Smarca4	UTSW	9	21,597,325 (GRCm39)	missense	probably damaging	1.00
R2512:Smarca4	UTSW	9	21,546,994 (GRCm39)	missense	possibly damaging	0.95
R2875:Smarca4	UTSW	9	21,553,876 (GRCm39)	missense	possibly damaging	0.55
R3786:Smarca4	UTSW	9	21,583,355 (GRCm39)	missense	possibly damaging	0.94
R4829:Smarca4	UTSW	9	21,550,623 (GRCm39)	missense	probably damaging	0.97
R5084:Smarca4	UTSW	9	21,572,059 (GRCm39)	missense	probably damaging	1.00
R5222:Smarca4	UTSW	9	21,567,002 (GRCm39)	missense	probably benign	0.01
R5785:Smarca4	UTSW	9	21,597,322 (GRCm39)	missense	probably damaging	0.99
R5844:Smarca4	UTSW	9	21,589,238 (GRCm39)	intron	probably benign
R5964:Smarca4	UTSW	9	21,558,726 (GRCm39)	missense	probably benign	0.00
R6001:Smarca4	UTSW	9	21,544,205 (GRCm39)	unclassified	probably benign
R6072:Smarca4	UTSW	9	21,611,417 (GRCm39)	missense	probably damaging	1.00
R6254:Smarca4	UTSW	9	21,611,173 (GRCm39)	missense	probably damaging	1.00
R6320:Smarca4	UTSW	9	21,548,671 (GRCm39)	missense	probably damaging	1.00
R6353:Smarca4	UTSW	9	21,590,445 (GRCm39)	critical splice donor site	probably null
R6461:Smarca4	UTSW	9	21,590,316 (GRCm39)	missense	probably damaging	1.00
R6886:Smarca4	UTSW	9	21,570,127 (GRCm39)	missense	probably damaging	1.00
R7098:Smarca4	UTSW	9	21,546,116 (GRCm39)	missense	probably benign	0.10
R7253:Smarca4	UTSW	9	21,570,256 (GRCm39)	missense	probably benign	0.01
R7307:Smarca4	UTSW	9	21,550,096 (GRCm39)	missense	probably damaging	1.00
R7382:Smarca4	UTSW	9	21,570,229 (GRCm39)	missense	probably damaging	0.98
R7445:Smarca4	UTSW	9	21,597,543 (GRCm39)	missense	probably damaging	1.00
R7535:Smarca4	UTSW	9	21,558,921 (GRCm39)	missense	possibly damaging	0.82
R7573:Smarca4	UTSW	9	21,550,371 (GRCm39)	splice site	probably null
R7644:Smarca4	UTSW	9	21,566,950 (GRCm39)	missense	probably benign	0.00
R7734:Smarca4	UTSW	9	21,578,658 (GRCm39)	missense	possibly damaging	0.65
R7833:Smarca4	UTSW	9	21,558,655 (GRCm39)	missense	possibly damaging	0.86
R8085:Smarca4	UTSW	9	21,570,108 (GRCm39)	splice site	probably null
R8119:Smarca4	UTSW	9	21,558,922 (GRCm39)	missense	possibly damaging	0.61
R8320:Smarca4	UTSW	9	21,588,798 (GRCm39)	missense	probably benign	0.10
R8445:Smarca4	UTSW	9	21,612,239 (GRCm39)	small deletion	probably benign
R8493:Smarca4	UTSW	9	21,570,144 (GRCm39)	missense	probably damaging	1.00
R8748:Smarca4	UTSW	9	21,546,164 (GRCm39)	missense	possibly damaging	0.85
R8788:Smarca4	UTSW	9	21,550,024 (GRCm39)	missense	probably damaging	1.00
R8817:Smarca4	UTSW	9	21,547,497 (GRCm39)	missense	probably benign	0.04
R9241:Smarca4	UTSW	9	21,550,604 (GRCm39)	missense	possibly damaging	0.72
R9446:Smarca4	UTSW	9	21,547,155 (GRCm39)	missense	unknown
R9570:Smarca4	UTSW	9	21,580,849 (GRCm39)	missense	probably damaging	1.00
R9727:Smarca4	UTSW	9	21,611,160 (GRCm39)	missense	probably damaging	1.00
R9801:Smarca4	UTSW	9	21,586,397 (GRCm39)	missense	probably damaging	1.00
Z1176:Smarca4	UTSW	9	21,614,253 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGGCATTTTGACATCCAGGGAAAGG -3'
(R):5'- GAGGCTGTCTGTGAACAAGCTAGG -3'

Sequencing Primer
(F):5'- CATCCAGGGAAAGGCTGTAGG -3'
(R):5'- ACATAATGCCGAGTCTGTCG -3'

Posted On

2013-07-30