Incidental Mutation 'R0666:Akap6'
ID62037
Institutional Source Beutler Lab
Gene Symbol Akap6
Ensembl Gene ENSMUSG00000061603
Gene NameA kinase (PRKA) anchor protein 6
Synonyms
MMRRC Submission 038851-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.656) question?
Stock #R0666 (G1)
Quality Score96
Status Validated
Chromosome12
Chromosomal Location52699383-53155599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52911808 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 782 (V782E)
Ref Sequence ENSEMBL: ENSMUSP00000151871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]
Predicted Effect probably damaging
Transcript: ENSMUST00000095737
AA Change: V782E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: V782E

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
Blast:SPEC 66 168 2e-50 BLAST
low complexity region 441 455 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
low complexity region 569 587 N/A INTRINSIC
low complexity region 640 651 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
SPEC 779 880 1.06e-1 SMART
SPEC 959 1057 1.45e0 SMART
SPEC 1078 1185 2.56e-2 SMART
low complexity region 1316 1332 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1610 1622 N/A INTRINSIC
low complexity region 1683 1698 N/A INTRINSIC
low complexity region 1737 1781 N/A INTRINSIC
low complexity region 1899 1910 N/A INTRINSIC
low complexity region 2019 2031 N/A INTRINSIC
low complexity region 2104 2115 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219786
AA Change: V782E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.174 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.7%
Validation Efficiency 100% (89/89)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T G 11: 78,287,987 M2026R probably damaging Het
2610507B11Rik T A 11: 78,277,212 L1491* probably null Het
Atg9a A G 1: 75,185,090 L604P probably damaging Het
Atp1a3 T C 7: 24,990,549 I482V probably benign Het
Ccdc105 C A 10: 78,750,547 L223F probably benign Het
Ccdc18 T G 5: 108,163,664 V412G probably benign Het
Cct6a A G 5: 129,794,386 noncoding transcript Het
Clpx A G 9: 65,310,225 N25S probably damaging Het
Cnpy2 T A 10: 128,327,025 C171* probably null Het
Cntnap3 C T 13: 64,757,397 D857N probably damaging Het
Col5a1 A G 2: 28,032,685 Y255C probably damaging Het
Coro7 A T 16: 4,631,911 F638Y possibly damaging Het
Cpd A G 11: 76,782,327 F1331L probably damaging Het
Csmd1 A T 8: 16,069,049 I1842N possibly damaging Het
Dgkg T A 16: 22,562,730 D490V probably damaging Het
Dnah9 A T 11: 66,085,458 M1255K probably benign Het
E2f1 A G 2: 154,560,929 V306A probably benign Het
Entpd1 A G 19: 40,659,906 probably benign Het
Esrrb T A 12: 86,505,902 I222N probably benign Het
Fam159b G T 13: 104,858,354 T95K possibly damaging Het
Flt4 G T 11: 49,625,447 A126S possibly damaging Het
Galnt11 C T 5: 25,252,147 T237I possibly damaging Het
Gbf1 A G 19: 46,262,544 probably benign Het
Gm20388 A T 8: 122,270,988 probably benign Het
Gm7030 T C 17: 36,127,834 T222A possibly damaging Het
Herc1 T A 9: 66,484,888 probably benign Het
Hsph1 T C 5: 149,631,502 Y105C probably damaging Het
Il23r T C 6: 67,434,680 T358A probably benign Het
Il2ra C T 2: 11,643,073 probably benign Het
Kbtbd4 G T 2: 90,914,115 probably benign Het
Kcnt1 A G 2: 25,891,243 probably benign Het
Kng2 A G 16: 22,997,122 probably benign Het
Lap3 C T 5: 45,511,928 T473I possibly damaging Het
Lrrk2 T C 15: 91,757,070 probably null Het
Map1s A G 8: 70,914,052 N534D possibly damaging Het
Mtg1 G A 7: 140,144,344 V122I probably benign Het
Myadm T A 7: 3,297,349 I209K probably damaging Het
Ntsr2 G A 12: 16,653,980 V75I probably benign Het
Olfr1037 G A 2: 86,085,213 A188V probably benign Het
Olfr1272 A T 2: 90,281,868 S236T probably damaging Het
Pfn1 T C 11: 70,654,366 T39A probably benign Het
Pipox T A 11: 77,883,825 K144M probably benign Het
Plekhh1 G A 12: 79,069,115 E811K probably damaging Het
Pnpla3 T A 15: 84,179,305 W295R probably benign Het
Prkacb T A 3: 146,751,518 T136S probably damaging Het
Ralbp1 T A 17: 65,854,129 N473I probably benign Het
Rbp4 G A 19: 38,118,460 T127M probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rps3a1 G A 3: 86,138,117 probably benign Het
Scg3 G T 9: 75,643,940 Y429* probably null Het
Spag5 T C 11: 78,313,396 S492P probably damaging Het
St7 T A 6: 17,934,239 M540K probably damaging Het
Stxbp3 C A 3: 108,805,302 V281F possibly damaging Het
Sun5 A G 2: 153,859,048 V242A possibly damaging Het
Susd5 G T 9: 114,095,784 R245L possibly damaging Het
Syne2 A G 12: 75,923,013 E954G probably damaging Het
Synpo2 A T 3: 123,114,059 V536E probably damaging Het
Tas2r140 T C 6: 133,055,442 I118V probably benign Het
Tbx18 C A 9: 87,724,409 V228L probably benign Het
Tdrd9 T A 12: 112,007,580 probably benign Het
Tg T C 15: 66,737,521 M310T probably benign Het
Ticam2 T A 18: 46,560,651 D123V probably damaging Het
Timm23 A G 14: 32,199,036 probably benign Het
Tinag C T 9: 77,005,687 R280H probably benign Het
Topbp1 G A 9: 103,308,812 R51K probably benign Het
Tor1b A G 2: 30,953,913 I121V probably damaging Het
Tpmt C A 13: 47,032,454 G148V probably damaging Het
Tubb1 A G 2: 174,457,755 E410G probably damaging Het
Ubash3b C A 9: 41,047,064 V7L possibly damaging Het
Ube2o C T 11: 116,542,835 E686K probably damaging Het
Unc13d T A 11: 116,069,492 probably benign Het
Vmn1r183 A T 7: 24,055,176 M135L probably benign Het
Wisp3 T C 10: 39,151,289 R316G probably benign Het
Xkr8 T C 4: 132,732,338 Y43C probably damaging Het
Zc3h4 T A 7: 16,434,772 N935K unknown Het
Zc3h7a G A 16: 11,156,303 probably benign Het
Zfp84 C T 7: 29,776,851 H323Y probably damaging Het
Zfp873 G T 10: 82,060,761 S442I possibly damaging Het
Zfp938 A G 10: 82,225,772 L338P probably damaging Het
Other mutations in Akap6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Akap6 APN 12 53140980 missense possibly damaging 0.79
IGL00505:Akap6 APN 12 52887102 missense possibly damaging 0.92
IGL01134:Akap6 APN 12 52937217 missense probably damaging 0.96
IGL01458:Akap6 APN 12 52886818 nonsense probably null
IGL01589:Akap6 APN 12 53139664 missense probably damaging 1.00
IGL01592:Akap6 APN 12 53142142 missense probably damaging 1.00
IGL01738:Akap6 APN 12 52886817 missense probably damaging 0.99
IGL01867:Akap6 APN 12 52888008 missense probably damaging 1.00
IGL02025:Akap6 APN 12 53140335 missense probably benign
IGL02041:Akap6 APN 12 53140653 missense probably damaging 1.00
IGL02058:Akap6 APN 12 53140555 missense probably damaging 1.00
IGL02194:Akap6 APN 12 52886823 missense probably benign 0.00
IGL02226:Akap6 APN 12 53010467 splice site probably benign
IGL02323:Akap6 APN 12 53140429 missense probably benign 0.00
IGL02449:Akap6 APN 12 53140188 missense probably damaging 1.00
IGL02475:Akap6 APN 12 53139494 missense probably benign 0.03
IGL02546:Akap6 APN 12 52880738 missense probably damaging 1.00
IGL02547:Akap6 APN 12 53140696 missense probably damaging 1.00
IGL02588:Akap6 APN 12 52886499 nonsense probably null
IGL02608:Akap6 APN 12 53010606 missense probably benign 0.39
IGL02884:Akap6 APN 12 52886622 missense probably benign 0.00
IGL02945:Akap6 APN 12 52880837 missense probably damaging 1.00
IGL03029:Akap6 APN 12 52886412 missense probably damaging 1.00
IGL03129:Akap6 APN 12 53140306 missense probably damaging 1.00
R0133:Akap6 UTSW 12 53139471 nonsense probably null
R0166:Akap6 UTSW 12 53140924 missense probably benign 0.04
R0189:Akap6 UTSW 12 53141254 missense probably benign 0.41
R0532:Akap6 UTSW 12 52887983 missense probably benign 0.00
R0632:Akap6 UTSW 12 52937148 missense probably damaging 1.00
R0723:Akap6 UTSW 12 53141902 missense probably damaging 1.00
R0763:Akap6 UTSW 12 53142214 missense possibly damaging 0.93
R0785:Akap6 UTSW 12 52886622 missense probably benign 0.00
R0879:Akap6 UTSW 12 52880799 missense probably damaging 1.00
R0880:Akap6 UTSW 12 53139508 missense possibly damaging 0.93
R1033:Akap6 UTSW 12 53069222 missense probably damaging 0.97
R1055:Akap6 UTSW 12 52880672 nonsense probably null
R1199:Akap6 UTSW 12 52796190 missense probably damaging 1.00
R1295:Akap6 UTSW 12 52887029 missense probably damaging 1.00
R1389:Akap6 UTSW 12 53139520 missense probably benign 0.15
R1471:Akap6 UTSW 12 53141496 missense probably benign 0.05
R1483:Akap6 UTSW 12 52796087 missense probably damaging 1.00
R1512:Akap6 UTSW 12 52937154 missense probably damaging 1.00
R1648:Akap6 UTSW 12 53142006 nonsense probably null
R1791:Akap6 UTSW 12 53069125 missense probably damaging 1.00
R1888:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1888:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1891:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1899:Akap6 UTSW 12 53141852 missense possibly damaging 0.95
R1917:Akap6 UTSW 12 53104612 missense probably benign 0.13
R1970:Akap6 UTSW 12 52938475 missense probably damaging 0.96
R1987:Akap6 UTSW 12 53140795 missense possibly damaging 0.78
R1988:Akap6 UTSW 12 53140795 missense possibly damaging 0.78
R2153:Akap6 UTSW 12 53141404 missense probably benign 0.03
R2567:Akap6 UTSW 12 52938373 missense probably damaging 1.00
R2568:Akap6 UTSW 12 52887278 missense possibly damaging 0.77
R3025:Akap6 UTSW 12 53140143 missense probably benign
R3051:Akap6 UTSW 12 52887033 missense probably damaging 1.00
R3195:Akap6 UTSW 12 53072457 nonsense probably null
R3196:Akap6 UTSW 12 53072457 nonsense probably null
R3426:Akap6 UTSW 12 52888034 missense probably damaging 1.00
R3783:Akap6 UTSW 12 52880769 missense probably damaging 1.00
R3934:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
R3936:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
R3967:Akap6 UTSW 12 53141453 missense probably damaging 1.00
R3970:Akap6 UTSW 12 53141453 missense probably damaging 1.00
R4042:Akap6 UTSW 12 53139379 critical splice acceptor site probably null
R4095:Akap6 UTSW 12 53139462 missense probably damaging 1.00
R4152:Akap6 UTSW 12 53140407 missense probably benign 0.45
R4231:Akap6 UTSW 12 53141038 missense probably damaging 1.00
R4232:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4233:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4234:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4235:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4236:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4475:Akap6 UTSW 12 53141643 missense probably benign 0.00
R4513:Akap6 UTSW 12 52796004 missense probably benign 0.03
R4686:Akap6 UTSW 12 52887623 frame shift probably null
R4724:Akap6 UTSW 12 52795885 missense possibly damaging 0.80
R4782:Akap6 UTSW 12 52887623 frame shift probably null
R4852:Akap6 UTSW 12 53104675 missense probably damaging 1.00
R5024:Akap6 UTSW 12 53142562 missense probably benign 0.01
R5116:Akap6 UTSW 12 53141515 missense probably benign 0.01
R5164:Akap6 UTSW 12 53142466 missense probably benign
R5225:Akap6 UTSW 12 52886546 missense probably damaging 1.00
R5269:Akap6 UTSW 12 53139843 missense probably damaging 0.99
R5352:Akap6 UTSW 12 52796097 missense probably damaging 1.00
R5496:Akap6 UTSW 12 53140653 missense possibly damaging 0.87
R5551:Akap6 UTSW 12 52795964 missense probably damaging 1.00
R5997:Akap6 UTSW 12 52937233 critical splice donor site probably null
R6137:Akap6 UTSW 12 53140354 missense probably damaging 1.00
R6151:Akap6 UTSW 12 53025792 missense probably damaging 1.00
R6169:Akap6 UTSW 12 53142358 missense probably benign
R6307:Akap6 UTSW 12 53141568 missense possibly damaging 0.85
R6351:Akap6 UTSW 12 53142025 missense probably damaging 0.98
R6479:Akap6 UTSW 12 53141169 missense probably damaging 1.00
R6502:Akap6 UTSW 12 53140215 missense probably damaging 1.00
R6760:Akap6 UTSW 12 53139778 missense probably damaging 1.00
R6778:Akap6 UTSW 12 53025816 missense probably damaging 1.00
R6837:Akap6 UTSW 12 53141262 missense probably damaging 1.00
R6896:Akap6 UTSW 12 52887494 missense probably benign 0.06
R6917:Akap6 UTSW 12 53069168 missense probably null 0.97
R6983:Akap6 UTSW 12 52887653 missense probably damaging 1.00
X0062:Akap6 UTSW 12 53142361 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TTGAGGTAACTTACGCAGTGCCC -3'
(R):5'- AATGGTCAGCTTGAGGCTTAACCC -3'

Sequencing Primer
(F):5'- caacccaacccaaaccaaac -3'
(R):5'- AGGCTTAACCCCATTAGAGCTTG -3'
Posted On2013-07-30