Incidental Mutation 'R0667:Avl9'
ID62059
Institutional Source Beutler Lab
Gene Symbol Avl9
Ensembl Gene ENSMUSG00000029787
Gene NameAVL9 cell migration associated
SynonymsD730049P16Rik, 5830411G16Rik
MMRRC Submission 038852-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R0667 (G1)
Quality Score93
Status Validated
Chromosome6
Chromosomal Location56714899-56761912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 56736483 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 242 (R242L)
Ref Sequence ENSEMBL: ENSMUSP00000031805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031805] [ENSMUST00000177249]
Predicted Effect probably benign
Transcript: ENSMUST00000031805
AA Change: R242L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000031805
Gene: ENSMUSG00000029787
AA Change: R242L

DomainStartEndE-ValueType
Pfam:Afi1 15 102 3.8e-11 PFAM
Pfam:Avl9 16 521 7.1e-160 PFAM
Pfam:DUF2347 19 175 1.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176560
Predicted Effect probably benign
Transcript: ENSMUST00000177249
SMART Domains Protein: ENSMUSP00000144696
Gene: ENSMUSG00000029787

DomainStartEndE-ValueType
Pfam:Afi1 15 111 2e-8 PFAM
Pfam:Avl9 16 209 3.9e-86 PFAM
Pfam:DUF2347 19 179 3.9e-8 PFAM
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C G 7: 140,261,537 S251R possibly damaging Het
Abca5 G T 11: 110,327,811 N76K probably benign Het
Adamts12 C T 15: 11,215,624 R244C probably damaging Het
Atad2 A G 15: 58,098,719 S1143P probably benign Het
Cand1 A G 10: 119,216,520 S234P probably benign Het
Cd200 T A 16: 45,394,857 I144L probably benign Het
Cep76 A T 18: 67,634,778 L228Q possibly damaging Het
Col12a1 A G 9: 79,628,462 L2584S probably damaging Het
Col6a3 A C 1: 90,828,101 D155E probably damaging Het
Col6a4 G A 9: 106,029,959 probably benign Het
Dsg2 A C 18: 20,573,499 D24A possibly damaging Het
Gm5901 G A 7: 105,377,490 S155N possibly damaging Het
Hkdc1 T C 10: 62,411,865 probably benign Het
Kansl1 A G 11: 104,343,538 V714A probably benign Het
Kcnh1 T A 1: 192,506,038 S936T probably benign Het
Klhdc3 A T 17: 46,677,225 F205I probably benign Het
Krt31 T A 11: 100,048,125 H290L probably benign Het
Lama2 T A 10: 27,344,410 probably null Het
Mep1a T G 17: 43,478,190 D565A probably benign Het
Mgme1 T A 2: 144,278,987 probably benign Het
Mtf2 C T 5: 108,104,503 T409I probably damaging Het
Mylk3 A G 8: 85,355,165 probably null Het
Myo1c A G 11: 75,668,512 E650G probably damaging Het
Nipbl A C 15: 8,361,004 D260E possibly damaging Het
Nufip2 T A 11: 77,692,013 V251D possibly damaging Het
Olfr1239 T C 2: 89,417,688 I242V probably benign Het
Olfr138 C A 17: 38,275,157 P129T probably damaging Het
Olfr855 T A 9: 19,585,447 N303K probably benign Het
Osm G T 11: 4,239,918 R234L possibly damaging Het
Pabpc1 G A 15: 36,598,031 A515V probably benign Het
Piwil1 T A 5: 128,741,478 probably null Het
Pld1 A G 3: 28,079,178 probably null Het
Plekhg3 C T 12: 76,576,598 R871C probably damaging Het
Ppfia2 A T 10: 106,913,694 Y1147F probably damaging Het
Prmt3 A G 7: 49,791,995 Y240C probably damaging Het
Prr36 G T 8: 4,216,311 probably benign Het
Ptprd A G 4: 75,957,346 I908T probably damaging Het
Sae1 A T 7: 16,368,532 N172K probably damaging Het
Satb1 T G 17: 51,782,861 Q319H probably damaging Het
Scn2a A T 2: 65,751,996 I1563F possibly damaging Het
Scn3a C A 2: 65,484,411 R1102L probably null Het
Serpinb9b T A 13: 33,032,926 L60* probably null Het
Setd1a A G 7: 127,786,593 D281G probably damaging Het
Slc8a1 C A 17: 81,648,881 V243F probably damaging Het
Tgfbr3 A T 5: 107,177,850 H115Q probably benign Het
Tiam1 C A 16: 89,897,984 S195I probably damaging Het
Tjp2 A G 19: 24,108,749 V803A probably benign Het
Ttc5 T A 14: 50,765,958 Q423L probably benign Het
Tyk2 A C 9: 21,108,871 V997G probably damaging Het
Uhrf1 T C 17: 56,310,677 V133A probably benign Het
Vmn2r107 A C 17: 20,355,654 Y82S possibly damaging Het
Vmn2r93 T C 17: 18,326,241 F792L probably damaging Het
Vps13c G A 9: 67,951,573 W2768* probably null Het
Zfp456 A T 13: 67,366,742 C282S probably benign Het
Zhx1 T C 15: 58,053,165 N562D possibly damaging Het
Zmynd15 G T 11: 70,465,118 G481C probably damaging Het
Other mutations in Avl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Avl9 APN 6 56725090 missense probably damaging 1.00
IGL01433:Avl9 APN 6 56753397 missense probably damaging 0.99
IGL02865:Avl9 APN 6 56736873 missense probably damaging 1.00
IGL02932:Avl9 APN 6 56736551 missense probably benign 0.00
Atlanta UTSW 6 56753390 missense possibly damaging 0.54
H8562:Avl9 UTSW 6 56757310 missense probably damaging 1.00
H8786:Avl9 UTSW 6 56757310 missense probably damaging 1.00
R0003:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0029:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0102:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0103:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0122:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0147:Avl9 UTSW 6 56736502 missense probably benign 0.00
R0372:Avl9 UTSW 6 56726324 critical splice donor site probably null
R0446:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0600:Avl9 UTSW 6 56736906 missense probably benign 0.03
R1560:Avl9 UTSW 6 56725128 nonsense probably null
R1566:Avl9 UTSW 6 56736482 nonsense probably null
R2069:Avl9 UTSW 6 56736435 splice site probably benign
R2362:Avl9 UTSW 6 56736570 missense probably benign 0.07
R2483:Avl9 UTSW 6 56736843 missense probably benign
R2941:Avl9 UTSW 6 56753885 missense probably benign 0.00
R3028:Avl9 UTSW 6 56730687 unclassified probably benign
R3437:Avl9 UTSW 6 56736627 missense probably benign
R3690:Avl9 UTSW 6 56736827 missense probably benign
R3691:Avl9 UTSW 6 56736827 missense probably benign
R3947:Avl9 UTSW 6 56728665 critical splice donor site probably null
R3948:Avl9 UTSW 6 56728665 critical splice donor site probably null
R3949:Avl9 UTSW 6 56728665 critical splice donor site probably null
R3972:Avl9 UTSW 6 56743408 missense probably damaging 1.00
R4734:Avl9 UTSW 6 56736494 missense probably damaging 0.96
R4739:Avl9 UTSW 6 56726309 missense probably damaging 1.00
R5661:Avl9 UTSW 6 56725102 nonsense probably null
R5664:Avl9 UTSW 6 56753839 missense probably damaging 1.00
R6010:Avl9 UTSW 6 56753390 missense possibly damaging 0.54
R6615:Avl9 UTSW 6 56753885 missense probably benign 0.00
R6719:Avl9 UTSW 6 56753385 missense probably damaging 1.00
R7138:Avl9 UTSW 6 56728257 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- tgctatcacactcaactTTCCCAGC -3'
(R):5'- ACAGTAATTGGAGGACTGTCCGAGG -3'

Sequencing Primer
(F):5'- acactcaactTTCCCAGCTTTTTC -3'
(R):5'- ACCTTCTACTTGGAAGTAAGGC -3'
Posted On2013-07-30