Incidental Mutation 'R0667:Prr36'
ID62064
Institutional Source Beutler Lab
Gene Symbol Prr36
Ensembl Gene ENSMUSG00000064125
Gene Nameproline rich 36
SynonymsBC068157
MMRRC Submission 038852-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R0667 (G1)
Quality Score115
Status Validated
Chromosome8
Chromosomal Location4209543-4217459 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to T at 4216311 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168386] [ENSMUST00000175906] [ENSMUST00000176227] [ENSMUST00000177491]
Predicted Effect unknown
Transcript: ENSMUST00000168386
AA Change: Q80K
SMART Domains Protein: ENSMUSP00000133114
Gene: ENSMUSG00000064125
AA Change: Q80K

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
internal_repeat_1 63 82 5.9e-10 PROSPERO
internal_repeat_1 87 106 5.9e-10 PROSPERO
low complexity region 109 123 N/A INTRINSIC
low complexity region 358 388 N/A INTRINSIC
low complexity region 390 425 N/A INTRINSIC
low complexity region 466 497 N/A INTRINSIC
low complexity region 543 567 N/A INTRINSIC
low complexity region 571 612 N/A INTRINSIC
low complexity region 647 726 N/A INTRINSIC
low complexity region 733 751 N/A INTRINSIC
low complexity region 755 780 N/A INTRINSIC
low complexity region 783 867 N/A INTRINSIC
low complexity region 1020 1045 N/A INTRINSIC
Pfam:DUF4596 1053 1098 4.1e-27 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000175906
AA Change: Q80K
SMART Domains Protein: ENSMUSP00000135713
Gene: ENSMUSG00000064125
AA Change: Q80K

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
internal_repeat_1 63 82 5.38e-8 PROSPERO
internal_repeat_1 87 106 5.38e-8 PROSPERO
low complexity region 109 123 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176227
Predicted Effect unknown
Transcript: ENSMUST00000177491
AA Change: Q80K
SMART Domains Protein: ENSMUSP00000135130
Gene: ENSMUSG00000064125
AA Change: Q80K

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
internal_repeat_1 63 82 1.65e-6 PROSPERO
internal_repeat_1 87 106 1.65e-6 PROSPERO
low complexity region 109 123 N/A INTRINSIC
Meta Mutation Damage Score 0.0568 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein of unknown function that contains internal regions of low complexity sequence. Alternative splicing results in multiple transcript variants. The transcript structure of the protein-coding variant at this locus is conserved between human and mouse. [provided by RefSeq, Oct 2013]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C G 7: 140,261,537 S251R possibly damaging Het
Abca5 G T 11: 110,327,811 N76K probably benign Het
Adamts12 C T 15: 11,215,624 R244C probably damaging Het
Atad2 A G 15: 58,098,719 S1143P probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Cand1 A G 10: 119,216,520 S234P probably benign Het
Cd200 T A 16: 45,394,857 I144L probably benign Het
Cep76 A T 18: 67,634,778 L228Q possibly damaging Het
Col12a1 A G 9: 79,628,462 L2584S probably damaging Het
Col6a3 A C 1: 90,828,101 D155E probably damaging Het
Col6a4 G A 9: 106,029,959 probably benign Het
Dsg2 A C 18: 20,573,499 D24A possibly damaging Het
Gm5901 G A 7: 105,377,490 S155N possibly damaging Het
Hkdc1 T C 10: 62,411,865 probably benign Het
Kansl1 A G 11: 104,343,538 V714A probably benign Het
Kcnh1 T A 1: 192,506,038 S936T probably benign Het
Klhdc3 A T 17: 46,677,225 F205I probably benign Het
Krt31 T A 11: 100,048,125 H290L probably benign Het
Lama2 T A 10: 27,344,410 probably null Het
Mep1a T G 17: 43,478,190 D565A probably benign Het
Mgme1 T A 2: 144,278,987 probably benign Het
Mtf2 C T 5: 108,104,503 T409I probably damaging Het
Mylk3 A G 8: 85,355,165 probably null Het
Myo1c A G 11: 75,668,512 E650G probably damaging Het
Nipbl A C 15: 8,361,004 D260E possibly damaging Het
Nufip2 T A 11: 77,692,013 V251D possibly damaging Het
Olfr1239 T C 2: 89,417,688 I242V probably benign Het
Olfr138 C A 17: 38,275,157 P129T probably damaging Het
Olfr855 T A 9: 19,585,447 N303K probably benign Het
Osm G T 11: 4,239,918 R234L possibly damaging Het
Pabpc1 G A 15: 36,598,031 A515V probably benign Het
Piwil1 T A 5: 128,741,478 probably null Het
Pld1 A G 3: 28,079,178 probably null Het
Plekhg3 C T 12: 76,576,598 R871C probably damaging Het
Ppfia2 A T 10: 106,913,694 Y1147F probably damaging Het
Prmt3 A G 7: 49,791,995 Y240C probably damaging Het
Ptprd A G 4: 75,957,346 I908T probably damaging Het
Sae1 A T 7: 16,368,532 N172K probably damaging Het
Satb1 T G 17: 51,782,861 Q319H probably damaging Het
Scn2a A T 2: 65,751,996 I1563F possibly damaging Het
Scn3a C A 2: 65,484,411 R1102L probably null Het
Serpinb9b T A 13: 33,032,926 L60* probably null Het
Setd1a A G 7: 127,786,593 D281G probably damaging Het
Slc8a1 C A 17: 81,648,881 V243F probably damaging Het
Tgfbr3 A T 5: 107,177,850 H115Q probably benign Het
Tiam1 C A 16: 89,897,984 S195I probably damaging Het
Tjp2 A G 19: 24,108,749 V803A probably benign Het
Ttc5 T A 14: 50,765,958 Q423L probably benign Het
Tyk2 A C 9: 21,108,871 V997G probably damaging Het
Uhrf1 T C 17: 56,310,677 V133A probably benign Het
Vmn2r107 A C 17: 20,355,654 Y82S possibly damaging Het
Vmn2r93 T C 17: 18,326,241 F792L probably damaging Het
Vps13c G A 9: 67,951,573 W2768* probably null Het
Zfp456 A T 13: 67,366,742 C282S probably benign Het
Zhx1 T C 15: 58,053,165 N562D possibly damaging Het
Zmynd15 G T 11: 70,465,118 G481C probably damaging Het
Other mutations in Prr36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Prr36 APN 8 4216230 missense probably benign 0.01
IGL01535:Prr36 APN 8 4214043 unclassified probably benign
IGL01658:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01710:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01712:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01713:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01892:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL01893:Prr36 APN 8 4215243 missense probably damaging 1.00
IGL02496:Prr36 APN 8 4216407 nonsense probably null
IGL02829:Prr36 APN 8 4215278 missense possibly damaging 0.55
R0479:Prr36 UTSW 8 4213930 nonsense probably null
R0784:Prr36 UTSW 8 4213771 unclassified probably benign
R1737:Prr36 UTSW 8 4214370 unclassified probably benign
R2017:Prr36 UTSW 8 4215205 missense probably benign 0.02
R2032:Prr36 UTSW 8 4214304 unclassified probably benign
R2430:Prr36 UTSW 8 4213488 unclassified probably benign
R4160:Prr36 UTSW 8 4212910 missense probably benign 0.10
R4184:Prr36 UTSW 8 4213409 unclassified probably benign
R4393:Prr36 UTSW 8 4214901 unclassified probably benign
R4887:Prr36 UTSW 8 4210881 missense probably benign 0.01
R5508:Prr36 UTSW 8 4216488 missense probably damaging 0.99
R5628:Prr36 UTSW 8 4216273 small deletion probably benign
R6189:Prr36 UTSW 8 4214177 unclassified probably benign
R6277:Prr36 UTSW 8 4214746 unclassified probably benign
R7185:Prr36 UTSW 8 4216458 missense probably damaging 1.00
R7286:Prr36 UTSW 8 4215163 critical splice donor site probably benign
R7338:Prr36 UTSW 8 4216212 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCCTTGCTTGGGGAATTAGGGAG -3'
(R):5'- GGATAGCGTCAAATCAGGAACTGCC -3'

Sequencing Primer
(F):5'- GGGGAATTAACTTATTACCTGGC -3'
(R):5'- GAATGCCGTCTTCACGACC -3'
Posted On2013-07-30