Incidental Mutation 'R0667:Pabpc1'
ID62078
Institutional Source Beutler Lab
Gene Symbol Pabpc1
Ensembl Gene ENSMUSG00000022283
Gene Namepoly(A) binding protein, cytoplasmic 1
SynonymsPabp1, Pabpl1
MMRRC Submission 038852-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #R0667 (G1)
Quality Score113
Status Validated
Chromosome15
Chromosomal Location36595661-36609668 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 36598031 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 515 (A515V)
Ref Sequence ENSEMBL: ENSMUSP00000001809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001809]
Predicted Effect probably benign
Transcript: ENSMUST00000001809
AA Change: A515V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000001809
Gene: ENSMUSG00000022283
AA Change: A515V

DomainStartEndE-ValueType
RRM 12 85 6.86e-22 SMART
RRM 100 171 2.72e-25 SMART
RRM 192 264 5.39e-29 SMART
RRM 295 366 5.83e-25 SMART
low complexity region 455 462 N/A INTRINSIC
low complexity region 492 509 N/A INTRINSIC
PolyA 554 617 6.9e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142357
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147116
Predicted Effect probably benign
Transcript: ENSMUST00000155116
SMART Domains Protein: ENSMUSP00000117063
Gene: ENSMUSG00000022283

DomainStartEndE-ValueType
PolyA 36 99 6.9e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226867
Meta Mutation Damage Score 0.126 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a poly(A) binding protein. The protein shuttles between the nucleus and cytoplasm and binds to the 3' poly(A) tail of eukaryotic messenger RNAs via RNA-recognition motifs. The binding of this protein to poly(A) promotes ribosome recruitment and translation initiation; it is also required for poly(A) shortening which is the first step in mRNA decay. The gene is part of a small gene family including three protein-coding genes and several pseudogenes.[provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C G 7: 140,261,537 S251R possibly damaging Het
Abca5 G T 11: 110,327,811 N76K probably benign Het
Adamts12 C T 15: 11,215,624 R244C probably damaging Het
Atad2 A G 15: 58,098,719 S1143P probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Cand1 A G 10: 119,216,520 S234P probably benign Het
Cd200 T A 16: 45,394,857 I144L probably benign Het
Cep76 A T 18: 67,634,778 L228Q possibly damaging Het
Col12a1 A G 9: 79,628,462 L2584S probably damaging Het
Col6a3 A C 1: 90,828,101 D155E probably damaging Het
Col6a4 G A 9: 106,029,959 probably benign Het
Dsg2 A C 18: 20,573,499 D24A possibly damaging Het
Gm5901 G A 7: 105,377,490 S155N possibly damaging Het
Hkdc1 T C 10: 62,411,865 probably benign Het
Kansl1 A G 11: 104,343,538 V714A probably benign Het
Kcnh1 T A 1: 192,506,038 S936T probably benign Het
Klhdc3 A T 17: 46,677,225 F205I probably benign Het
Krt31 T A 11: 100,048,125 H290L probably benign Het
Lama2 T A 10: 27,344,410 probably null Het
Mep1a T G 17: 43,478,190 D565A probably benign Het
Mgme1 T A 2: 144,278,987 probably benign Het
Mtf2 C T 5: 108,104,503 T409I probably damaging Het
Mylk3 A G 8: 85,355,165 probably null Het
Myo1c A G 11: 75,668,512 E650G probably damaging Het
Nipbl A C 15: 8,361,004 D260E possibly damaging Het
Nufip2 T A 11: 77,692,013 V251D possibly damaging Het
Olfr1239 T C 2: 89,417,688 I242V probably benign Het
Olfr138 C A 17: 38,275,157 P129T probably damaging Het
Olfr855 T A 9: 19,585,447 N303K probably benign Het
Osm G T 11: 4,239,918 R234L possibly damaging Het
Piwil1 T A 5: 128,741,478 probably null Het
Pld1 A G 3: 28,079,178 probably null Het
Plekhg3 C T 12: 76,576,598 R871C probably damaging Het
Ppfia2 A T 10: 106,913,694 Y1147F probably damaging Het
Prmt3 A G 7: 49,791,995 Y240C probably damaging Het
Prr36 G T 8: 4,216,311 probably benign Het
Ptprd A G 4: 75,957,346 I908T probably damaging Het
Sae1 A T 7: 16,368,532 N172K probably damaging Het
Satb1 T G 17: 51,782,861 Q319H probably damaging Het
Scn2a A T 2: 65,751,996 I1563F possibly damaging Het
Scn3a C A 2: 65,484,411 R1102L probably null Het
Serpinb9b T A 13: 33,032,926 L60* probably null Het
Setd1a A G 7: 127,786,593 D281G probably damaging Het
Slc8a1 C A 17: 81,648,881 V243F probably damaging Het
Tgfbr3 A T 5: 107,177,850 H115Q probably benign Het
Tiam1 C A 16: 89,897,984 S195I probably damaging Het
Tjp2 A G 19: 24,108,749 V803A probably benign Het
Ttc5 T A 14: 50,765,958 Q423L probably benign Het
Tyk2 A C 9: 21,108,871 V997G probably damaging Het
Uhrf1 T C 17: 56,310,677 V133A probably benign Het
Vmn2r107 A C 17: 20,355,654 Y82S possibly damaging Het
Vmn2r93 T C 17: 18,326,241 F792L probably damaging Het
Vps13c G A 9: 67,951,573 W2768* probably null Het
Zfp456 A T 13: 67,366,742 C282S probably benign Het
Zhx1 T C 15: 58,053,165 N562D possibly damaging Het
Zmynd15 G T 11: 70,465,118 G481C probably damaging Het
Other mutations in Pabpc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01602:Pabpc1 APN 15 36599306 missense probably benign 0.36
IGL01605:Pabpc1 APN 15 36599306 missense probably benign 0.36
IGL01973:Pabpc1 APN 15 36599275 missense probably benign 0.13
R0309:Pabpc1 UTSW 15 36597493 missense possibly damaging 0.93
R0883:Pabpc1 UTSW 15 36599054 unclassified probably benign
R1682:Pabpc1 UTSW 15 36605541 missense possibly damaging 0.75
R1749:Pabpc1 UTSW 15 36608340 missense probably damaging 1.00
R4731:Pabpc1 UTSW 15 36599284 missense probably benign 0.21
R4732:Pabpc1 UTSW 15 36599284 missense probably benign 0.21
R4733:Pabpc1 UTSW 15 36599284 missense probably benign 0.21
R4825:Pabpc1 UTSW 15 36597011 missense probably damaging 0.98
R5324:Pabpc1 UTSW 15 36600625 missense probably damaging 1.00
R5328:Pabpc1 UTSW 15 36602877 missense probably benign 0.03
R5711:Pabpc1 UTSW 15 36605830 missense probably benign 0.03
R6073:Pabpc1 UTSW 15 36600651 missense probably damaging 0.97
R6751:Pabpc1 UTSW 15 36597534 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AGACACCACATAGGGAGACTGCTG -3'
(R):5'- AGGTTCCACGAGTCATGTCAACAC -3'

Sequencing Primer
(F):5'- CGTCAACTTTCTTCACATAGAACC -3'
(R):5'- CAGCGTGTTGGTGAGTCTTA -3'
Posted On2013-07-30