Incidental Mutation 'R0667:Cep76'
ID62084
Institutional Source Beutler Lab
Gene Symbol Cep76
Ensembl Gene ENSMUSG00000073542
Gene Namecentrosomal protein 76
Synonyms
MMRRC Submission 038852-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0667 (G1)
Quality Score151
Status Validated
Chromosome18
Chromosomal Location67617397-67641336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67634778 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 228 (L228Q)
Ref Sequence ENSEMBL: ENSMUSP00000095149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097542]
Predicted Effect possibly damaging
Transcript: ENSMUST00000097542
AA Change: L228Q

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095149
Gene: ENSMUSG00000073542
AA Change: L228Q

DomainStartEndE-ValueType
Pfam:CEP76-C2 99 258 4.1e-64 PFAM
low complexity region 383 393 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Blast:KIND 604 654 2e-27 BLAST
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein which regulates centriole amplification by limiting centriole duplication to once per cell cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik C G 7: 140,261,537 S251R possibly damaging Het
Abca5 G T 11: 110,327,811 N76K probably benign Het
Adamts12 C T 15: 11,215,624 R244C probably damaging Het
Atad2 A G 15: 58,098,719 S1143P probably benign Het
Avl9 G T 6: 56,736,483 R242L probably benign Het
Cand1 A G 10: 119,216,520 S234P probably benign Het
Cd200 T A 16: 45,394,857 I144L probably benign Het
Col12a1 A G 9: 79,628,462 L2584S probably damaging Het
Col6a3 A C 1: 90,828,101 D155E probably damaging Het
Col6a4 G A 9: 106,029,959 probably benign Het
Dsg2 A C 18: 20,573,499 D24A possibly damaging Het
Gm5901 G A 7: 105,377,490 S155N possibly damaging Het
Hkdc1 T C 10: 62,411,865 probably benign Het
Kansl1 A G 11: 104,343,538 V714A probably benign Het
Kcnh1 T A 1: 192,506,038 S936T probably benign Het
Klhdc3 A T 17: 46,677,225 F205I probably benign Het
Krt31 T A 11: 100,048,125 H290L probably benign Het
Lama2 T A 10: 27,344,410 probably null Het
Mep1a T G 17: 43,478,190 D565A probably benign Het
Mgme1 T A 2: 144,278,987 probably benign Het
Mtf2 C T 5: 108,104,503 T409I probably damaging Het
Mylk3 A G 8: 85,355,165 probably null Het
Myo1c A G 11: 75,668,512 E650G probably damaging Het
Nipbl A C 15: 8,361,004 D260E possibly damaging Het
Nufip2 T A 11: 77,692,013 V251D possibly damaging Het
Olfr1239 T C 2: 89,417,688 I242V probably benign Het
Olfr138 C A 17: 38,275,157 P129T probably damaging Het
Olfr855 T A 9: 19,585,447 N303K probably benign Het
Osm G T 11: 4,239,918 R234L possibly damaging Het
Pabpc1 G A 15: 36,598,031 A515V probably benign Het
Piwil1 T A 5: 128,741,478 probably null Het
Pld1 A G 3: 28,079,178 probably null Het
Plekhg3 C T 12: 76,576,598 R871C probably damaging Het
Ppfia2 A T 10: 106,913,694 Y1147F probably damaging Het
Prmt3 A G 7: 49,791,995 Y240C probably damaging Het
Prr36 G T 8: 4,216,311 probably benign Het
Ptprd A G 4: 75,957,346 I908T probably damaging Het
Sae1 A T 7: 16,368,532 N172K probably damaging Het
Satb1 T G 17: 51,782,861 Q319H probably damaging Het
Scn2a A T 2: 65,751,996 I1563F possibly damaging Het
Scn3a C A 2: 65,484,411 R1102L probably null Het
Serpinb9b T A 13: 33,032,926 L60* probably null Het
Setd1a A G 7: 127,786,593 D281G probably damaging Het
Slc8a1 C A 17: 81,648,881 V243F probably damaging Het
Tgfbr3 A T 5: 107,177,850 H115Q probably benign Het
Tiam1 C A 16: 89,897,984 S195I probably damaging Het
Tjp2 A G 19: 24,108,749 V803A probably benign Het
Ttc5 T A 14: 50,765,958 Q423L probably benign Het
Tyk2 A C 9: 21,108,871 V997G probably damaging Het
Uhrf1 T C 17: 56,310,677 V133A probably benign Het
Vmn2r107 A C 17: 20,355,654 Y82S possibly damaging Het
Vmn2r93 T C 17: 18,326,241 F792L probably damaging Het
Vps13c G A 9: 67,951,573 W2768* probably null Het
Zfp456 A T 13: 67,366,742 C282S probably benign Het
Zhx1 T C 15: 58,053,165 N562D possibly damaging Het
Zmynd15 G T 11: 70,465,118 G481C probably damaging Het
Other mutations in Cep76
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01333:Cep76 APN 18 67640117 missense probably benign 0.01
IGL01344:Cep76 APN 18 67623397 missense possibly damaging 0.95
IGL02426:Cep76 APN 18 67634917 missense probably benign
IGL02544:Cep76 APN 18 67634950 splice site probably benign
IGL02711:Cep76 APN 18 67638336 missense probably benign
IGL03283:Cep76 APN 18 67640069 missense possibly damaging 0.76
R0117:Cep76 UTSW 18 67626674 missense possibly damaging 0.91
R0450:Cep76 UTSW 18 67634780 missense probably benign 0.30
R0469:Cep76 UTSW 18 67634780 missense probably benign 0.30
R0587:Cep76 UTSW 18 67623175 nonsense probably null
R0658:Cep76 UTSW 18 67623304 missense probably damaging 1.00
R1508:Cep76 UTSW 18 67623288 missense probably damaging 1.00
R1511:Cep76 UTSW 18 67624958 missense probably benign
R4280:Cep76 UTSW 18 67640159 missense probably benign 0.39
R4355:Cep76 UTSW 18 67626640 missense probably benign 0.02
R4702:Cep76 UTSW 18 67634898 missense possibly damaging 0.48
R4847:Cep76 UTSW 18 67619569 missense probably benign 0.04
R5650:Cep76 UTSW 18 67625066 missense probably damaging 1.00
R5897:Cep76 UTSW 18 67638328 missense probably benign 0.00
R6648:Cep76 UTSW 18 67619734 missense probably benign 0.27
R7193:Cep76 UTSW 18 67641134 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGAAAGCCTACAGTGGCGTCTTC -3'
(R):5'- CTGGCAGGTCAGTCATAGAAACAGG -3'

Sequencing Primer
(F):5'- AGTGGCGTCTTCCAGACAC -3'
(R):5'- actaccacttaactacatccttagc -3'
Posted On2013-07-30