Incidental Mutation 'R0668:Jph1'
ID62085
Institutional Source Beutler Lab
Gene Symbol Jph1
Ensembl Gene ENSMUSG00000042686
Gene Namejunctophilin 1
SynonymsENSMUSG00000054314, mitsugumin72, JP-1
MMRRC Submission 038853-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.769) question?
Stock #R0668 (G1)
Quality Score161
Status Not validated
Chromosome1
Chromosomal Location16964560-17097889 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17091671 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 256 (T256S)
Ref Sequence ENSEMBL: ENSMUSP00000039072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038382]
Predicted Effect probably damaging
Transcript: ENSMUST00000038382
AA Change: T256S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039072
Gene: ENSMUSG00000042686
AA Change: T256S

DomainStartEndE-ValueType
MORN 12 33 7.31e-1 SMART
MORN 36 56 7.6e1 SMART
MORN 58 79 2.49e-1 SMART
Pfam:MORN 82 99 8.9e-3 PFAM
MORN 104 125 3.72e-4 SMART
MORN 127 148 7.86e-3 SMART
low complexity region 204 220 N/A INTRINSIC
low complexity region 224 241 N/A INTRINSIC
MORN 279 300 2.07e-2 SMART
MORN 302 323 2.86e-5 SMART
low complexity region 382 400 N/A INTRINSIC
low complexity region 465 491 N/A INTRINSIC
transmembrane domain 637 659 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186604
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Junctional complexes between the plasma membrane and endoplasmic/sarcoplasmic reticulum are a common feature of all excitable cell types and mediate cross talk between cell surface and intracellular ion channels. The protein encoded by this gene is a component of junctional complexes and is composed of a C-terminal hydrophobic segment spanning the endoplasmic/sarcoplasmic reticulum membrane and a remaining cytoplasmic domain that shows specific affinity for the plasma membrane. This gene is a member of the junctophilin gene family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation fail to suckle and die shortly after birth. Mutants exhibit deficiencies of triad junctions and contraction in skeletal muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G T 1: 71,263,614 Q2149K probably damaging Het
Aifm1 T C X: 48,494,791 Q210R probably benign Het
Arhgef1 A G 7: 24,907,920 N31D possibly damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Cfb G T 17: 34,857,103 Q1176K probably benign Het
Chdh A G 14: 30,035,880 H447R probably damaging Het
Cpd A C 11: 76,784,398 V1299G probably damaging Het
Dnase1l3 A G 14: 7,968,086 probably null Het
Dnhd1 A G 7: 105,695,751 T2101A probably benign Het
Fchsd2 A G 7: 101,196,920 K188E possibly damaging Het
Gm10549 A G 18: 33,470,850 T129A unknown Het
Gm11639 A T 11: 104,720,492 I387F probably benign Het
Gm15448 G A 7: 3,822,700 T390I probably damaging Het
Kcnma1 A G 14: 23,367,495 Y768H probably damaging Het
Lcmt1 G A 7: 123,402,871 D120N probably damaging Het
Ly6g6d G A 17: 35,071,739 H72Y probably damaging Het
Myom3 A G 4: 135,764,926 D127G possibly damaging Het
Olfr95 T A 17: 37,211,644 I70F probably damaging Het
Sart1 T C 19: 5,384,256 Y249C probably damaging Het
Scin A G 12: 40,080,949 Y322H probably damaging Het
Slc44a3 T C 3: 121,510,203 T295A probably damaging Het
Slc4a5 T A 6: 83,271,072 L535Q probably damaging Het
Them5 A T 3: 94,344,413 K110N probably benign Het
Uhrf1bp1 A T 17: 27,895,939 I1408F probably benign Het
Vmn1r32 T A 6: 66,553,660 Q44L possibly damaging Het
Vmn2r93 T A 17: 18,298,405 M42K probably benign Het
Zfp143 A T 7: 110,061,274 probably benign Het
Other mutations in Jph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00732:Jph1 APN 1 17091740 missense probably damaging 1.00
IGL01382:Jph1 APN 1 17016156 missense probably damaging 1.00
IGL01936:Jph1 APN 1 17097384 missense probably damaging 0.98
IGL02012:Jph1 APN 1 17097414 missense probably benign 0.00
IGL02142:Jph1 APN 1 17091660 missense probably damaging 0.99
IGL02212:Jph1 APN 1 17091757 missense probably damaging 1.00
IGL02317:Jph1 APN 1 17003923 missense probably benign
IGL02450:Jph1 APN 1 17003977 missense possibly damaging 0.77
IGL02707:Jph1 APN 1 17004451 missense probably benign
R0893:Jph1 UTSW 1 17004283 nonsense probably null
R1308:Jph1 UTSW 1 17091694 missense probably damaging 1.00
R1318:Jph1 UTSW 1 16997490 missense probably damaging 1.00
R1495:Jph1 UTSW 1 17091652 missense probably benign
R1712:Jph1 UTSW 1 17097232 missense possibly damaging 0.57
R1916:Jph1 UTSW 1 17092055 missense probably damaging 1.00
R4492:Jph1 UTSW 1 16997546 missense probably damaging 1.00
R4559:Jph1 UTSW 1 17004511 missense probably benign
R4565:Jph1 UTSW 1 17004202 missense possibly damaging 0.91
R4694:Jph1 UTSW 1 16997505 missense probably damaging 0.98
R4700:Jph1 UTSW 1 17091704 missense possibly damaging 0.82
R4906:Jph1 UTSW 1 17091611 missense probably damaging 1.00
R5029:Jph1 UTSW 1 17091391 missense possibly damaging 0.85
R5256:Jph1 UTSW 1 17091398 missense probably benign 0.38
R5316:Jph1 UTSW 1 17091526 missense probably damaging 1.00
R5691:Jph1 UTSW 1 17004363 missense probably benign 0.21
R6209:Jph1 UTSW 1 17097586 missense probably damaging 0.98
R6380:Jph1 UTSW 1 17091847 missense probably damaging 1.00
R6645:Jph1 UTSW 1 17091761 missense probably damaging 1.00
R6829:Jph1 UTSW 1 17004423 missense probably damaging 1.00
R7007:Jph1 UTSW 1 17004186 missense possibly damaging 0.85
R7276:Jph1 UTSW 1 17092042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTGCTTCCTTATCCCACGGAC -3'
(R):5'- AACTTCCATGCGGACACGGAAC -3'

Sequencing Primer
(F):5'- CTTCTTTGGAGCCATCAGGAAAC -3'
(R):5'- CGGACACGGAACTGGGC -3'
Posted On2013-07-30