Incidental Mutation 'R0668:Slc44a3'
ID62089
Institutional Source Beutler Lab
Gene Symbol Slc44a3
Ensembl Gene ENSMUSG00000039865
Gene Namesolute carrier family 44, member 3
Synonyms
MMRRC Submission 038853-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R0668 (G1)
Quality Score105
Status Not validated
Chromosome3
Chromosomal Location121459528-121532404 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121510203 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 295 (T295A)
Ref Sequence ENSEMBL: ENSMUSP00000040210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039197]
Predicted Effect probably damaging
Transcript: ENSMUST00000039197
AA Change: T295A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040210
Gene: ENSMUSG00000039865
AA Change: T295A

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 217 239 N/A INTRINSIC
transmembrane domain 244 266 N/A INTRINSIC
Pfam:Choline_transpo 291 607 2.3e-80 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G T 1: 71,263,614 Q2149K probably damaging Het
Aifm1 T C X: 48,494,791 Q210R probably benign Het
Arhgef1 A G 7: 24,907,920 N31D possibly damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Cfb G T 17: 34,857,103 Q1176K probably benign Het
Chdh A G 14: 30,035,880 H447R probably damaging Het
Cpd A C 11: 76,784,398 V1299G probably damaging Het
Dnase1l3 A G 14: 7,968,086 probably null Het
Dnhd1 A G 7: 105,695,751 T2101A probably benign Het
Fchsd2 A G 7: 101,196,920 K188E possibly damaging Het
Gm10549 A G 18: 33,470,850 T129A unknown Het
Gm11639 A T 11: 104,720,492 I387F probably benign Het
Gm15448 G A 7: 3,822,700 T390I probably damaging Het
Jph1 T A 1: 17,091,671 T256S probably damaging Het
Kcnma1 A G 14: 23,367,495 Y768H probably damaging Het
Lcmt1 G A 7: 123,402,871 D120N probably damaging Het
Ly6g6d G A 17: 35,071,739 H72Y probably damaging Het
Myom3 A G 4: 135,764,926 D127G possibly damaging Het
Olfr95 T A 17: 37,211,644 I70F probably damaging Het
Sart1 T C 19: 5,384,256 Y249C probably damaging Het
Scin A G 12: 40,080,949 Y322H probably damaging Het
Slc4a5 T A 6: 83,271,072 L535Q probably damaging Het
Them5 A T 3: 94,344,413 K110N probably benign Het
Uhrf1bp1 A T 17: 27,895,939 I1408F probably benign Het
Vmn1r32 T A 6: 66,553,660 Q44L possibly damaging Het
Vmn2r93 T A 17: 18,298,405 M42K probably benign Het
Zfp143 A T 7: 110,061,274 probably benign Het
Other mutations in Slc44a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Slc44a3 APN 3 121527193 missense probably damaging 1.00
IGL01527:Slc44a3 APN 3 121527128 missense probably damaging 1.00
IGL02304:Slc44a3 APN 3 121527074 missense possibly damaging 0.48
IGL02419:Slc44a3 APN 3 121490257 missense probably benign 0.03
IGL02836:Slc44a3 APN 3 121531717 missense probably damaging 1.00
IGL02937:Slc44a3 APN 3 121510321 splice site probably benign
IGL03219:Slc44a3 APN 3 121463520 missense probably damaging 1.00
R0597:Slc44a3 UTSW 3 121460070 missense probably benign
R1355:Slc44a3 UTSW 3 121531671 missense probably damaging 1.00
R1608:Slc44a3 UTSW 3 121497847 nonsense probably null
R1617:Slc44a3 UTSW 3 121461265 missense probably benign 0.19
R1912:Slc44a3 UTSW 3 121532166 missense probably benign 0.00
R2027:Slc44a3 UTSW 3 121463410 splice site probably benign
R2087:Slc44a3 UTSW 3 121525670 missense probably damaging 0.99
R2199:Slc44a3 UTSW 3 121513744 missense probably benign 0.02
R4707:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R4736:Slc44a3 UTSW 3 121510206 missense probably damaging 0.97
R4784:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R4785:Slc44a3 UTSW 3 121527074 missense possibly damaging 0.48
R5302:Slc44a3 UTSW 3 121510313 missense probably damaging 1.00
R5835:Slc44a3 UTSW 3 121527200 missense probably benign 0.03
R6252:Slc44a3 UTSW 3 121513737 missense probably damaging 0.99
R6991:Slc44a3 UTSW 3 121532165 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCCTTCACCCACGAATTGCTTAG -3'
(R):5'- AACCTGGCTTGGCACAGATCAC -3'

Sequencing Primer
(F):5'- ACGAATTGCTTAGCCTTCTCTG -3'
(R):5'- ACAGTGGTTGTATTtgtgtgtg -3'
Posted On2013-07-30