Incidental Mutation 'R0668:Myom3'
ID62090
Institutional Source Beutler Lab
Gene Symbol Myom3
Ensembl Gene ENSMUSG00000037139
Gene Namemyomesin family, member 3
Synonyms8430427K15Rik
MMRRC Submission 038853-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R0668 (G1)
Quality Score89
Status Not validated
Chromosome4
Chromosomal Location135759715-135815564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135764926 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 127 (D127G)
Ref Sequence ENSEMBL: ENSMUSP00000101480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105854]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105854
AA Change: D127G

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101480
Gene: ENSMUSG00000037139
AA Change: D127G

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
low complexity region 53 83 N/A INTRINSIC
coiled coil region 119 150 N/A INTRINSIC
IG 160 248 7.64e-9 SMART
IG 277 364 1.37e-1 SMART
FN3 374 457 4.8e-13 SMART
FN3 502 585 9.99e-11 SMART
FN3 603 684 1.74e-10 SMART
FN3 702 785 2.5e-11 SMART
FN3 804 887 7.73e-17 SMART
Blast:IG_like 904 1098 1e-100 BLAST
PDB:2JTD|A 1000 1105 4e-25 PDB
low complexity region 1107 1119 N/A INTRINSIC
IG 1127 1209 4.46e-1 SMART
IGc2 1349 1416 1.4e-7 SMART
Meta Mutation Damage Score 0.098 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.6%
  • 20x: 91.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 G T 1: 71,263,614 Q2149K probably damaging Het
Aifm1 T C X: 48,494,791 Q210R probably benign Het
Arhgef1 A G 7: 24,907,920 N31D possibly damaging Het
Asic5 T A 3: 82,021,001 Y424N probably damaging Het
Cfb G T 17: 34,857,103 Q1176K probably benign Het
Chdh A G 14: 30,035,880 H447R probably damaging Het
Cpd A C 11: 76,784,398 V1299G probably damaging Het
Dnase1l3 A G 14: 7,968,086 probably null Het
Dnhd1 A G 7: 105,695,751 T2101A probably benign Het
Fchsd2 A G 7: 101,196,920 K188E possibly damaging Het
Gm10549 A G 18: 33,470,850 T129A unknown Het
Gm11639 A T 11: 104,720,492 I387F probably benign Het
Gm15448 G A 7: 3,822,700 T390I probably damaging Het
Jph1 T A 1: 17,091,671 T256S probably damaging Het
Kcnma1 A G 14: 23,367,495 Y768H probably damaging Het
Lcmt1 G A 7: 123,402,871 D120N probably damaging Het
Ly6g6d G A 17: 35,071,739 H72Y probably damaging Het
Olfr95 T A 17: 37,211,644 I70F probably damaging Het
Sart1 T C 19: 5,384,256 Y249C probably damaging Het
Scin A G 12: 40,080,949 Y322H probably damaging Het
Slc44a3 T C 3: 121,510,203 T295A probably damaging Het
Slc4a5 T A 6: 83,271,072 L535Q probably damaging Het
Them5 A T 3: 94,344,413 K110N probably benign Het
Uhrf1bp1 A T 17: 27,895,939 I1408F probably benign Het
Vmn1r32 T A 6: 66,553,660 Q44L possibly damaging Het
Vmn2r93 T A 17: 18,298,405 M42K probably benign Het
Zfp143 A T 7: 110,061,274 probably benign Het
Other mutations in Myom3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Myom3 APN 4 135762571 missense possibly damaging 0.66
IGL01490:Myom3 APN 4 135810778 missense possibly damaging 0.79
IGL01931:Myom3 APN 4 135789639 missense probably benign 0.05
IGL01935:Myom3 APN 4 135788381 missense probably damaging 1.00
IGL01939:Myom3 APN 4 135765589 missense possibly damaging 0.95
IGL01981:Myom3 APN 4 135785849 nonsense probably null
IGL01985:Myom3 APN 4 135765702 critical splice donor site probably null
IGL02043:Myom3 APN 4 135770675 missense probably damaging 1.00
IGL02477:Myom3 APN 4 135779368 missense probably benign 0.22
IGL02733:Myom3 APN 4 135814303 nonsense probably null
IGL03253:Myom3 APN 4 135783097 missense possibly damaging 0.85
R0359:Myom3 UTSW 4 135778143 missense probably damaging 1.00
R0525:Myom3 UTSW 4 135764926 missense possibly damaging 0.69
R0665:Myom3 UTSW 4 135764926 missense possibly damaging 0.69
R0690:Myom3 UTSW 4 135788426 splice site probably benign
R1235:Myom3 UTSW 4 135789543 missense probably benign 0.09
R1692:Myom3 UTSW 4 135775551 missense probably benign 0.00
R1793:Myom3 UTSW 4 135810755 missense probably benign 0.42
R1859:Myom3 UTSW 4 135779396 missense probably benign 0.01
R1863:Myom3 UTSW 4 135778037 missense probably benign
R1876:Myom3 UTSW 4 135779400 missense probably benign 0.01
R2103:Myom3 UTSW 4 135776412 missense probably benign 0.05
R2152:Myom3 UTSW 4 135803233 missense probably benign 0.05
R4633:Myom3 UTSW 4 135775699 missense probably benign 0.00
R4726:Myom3 UTSW 4 135807275 splice site probably null
R4884:Myom3 UTSW 4 135783055 missense possibly damaging 0.90
R4943:Myom3 UTSW 4 135814274 missense possibly damaging 0.73
R5040:Myom3 UTSW 4 135789659 missense probably damaging 1.00
R5151:Myom3 UTSW 4 135789572 missense probably benign 0.01
R5158:Myom3 UTSW 4 135765586 missense probably damaging 0.99
R5169:Myom3 UTSW 4 135775578 missense probably benign 0.01
R5239:Myom3 UTSW 4 135800992 splice site probably benign
R6130:Myom3 UTSW 4 135762571 missense probably benign
R6253:Myom3 UTSW 4 135785892 missense probably benign 0.07
R6253:Myom3 UTSW 4 135801003 missense probably benign 0.00
R6331:Myom3 UTSW 4 135776377 missense possibly damaging 0.46
R6346:Myom3 UTSW 4 135806051 missense probably benign 0.00
R6502:Myom3 UTSW 4 135762513 start gained probably benign
R6613:Myom3 UTSW 4 135812459 missense possibly damaging 0.80
R6899:Myom3 UTSW 4 135803292 missense probably damaging 1.00
R6969:Myom3 UTSW 4 135801060 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTCCTACAGGGAAGCTAAGCTGAG -3'
(R):5'- CACAGGGGTTACATAAAGAAGCCCG -3'

Sequencing Primer
(F):5'- AAGCTAAGCTGAGACGCC -3'
(R):5'- GTCTTCTAGACACTGGGAAGTCATC -3'
Posted On2013-07-30