Incidental Mutation 'R0669:Krt72'
ID62160
Institutional Source Beutler Lab
Gene Symbol Krt72
Ensembl Gene ENSMUSG00000056605
Gene Namekeratin 72
SynonymsKrt72-ps, K6irs2
MMRRC Submission 038854-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R0669 (G1)
Quality Score205
Status Validated
Chromosome15
Chromosomal Location101776172-101786460 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101778305 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 402 (E402G)
Ref Sequence ENSEMBL: ENSMUSP00000065922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071104]
Predicted Effect probably damaging
Transcript: ENSMUST00000071104
AA Change: E402G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000065922
Gene: ENSMUSG00000056605
AA Change: E402G

DomainStartEndE-ValueType
Pfam:Keratin_2_head 59 130 3.1e-17 PFAM
Filament 133 446 6.9e-157 SMART
low complexity region 454 462 N/A INTRINSIC
low complexity region 465 481 N/A INTRINSIC
low complexity region 507 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127671
Meta Mutation Damage Score 0.36 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 95.8%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells. The type II keratins consist of basic or neutral proteins which are arranged in pairs of heterotypic keratin chains coexpressed during differentiation of simple and stratified epithelial tissues. This gene encodes a type II keratin that is specifically expressed in the inner root sheath of hair follicles. The type II keratins are clustered in a region of chromosome 12q12-q13. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2009]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik T A 11: 72,198,845 H71L possibly damaging Het
A230050P20Rik AGAGGAGGAGGAGGAGGAGGAGGAGGA AGAGGAGGAGGAGGAGGAGGAGGA 9: 20,873,717 probably benign Het
Abcb11 C A 2: 69,329,318 V10L probably benign Het
Abcb9 T C 5: 124,062,887 T689A probably damaging Het
Adam22 A G 5: 8,143,036 probably benign Het
Adamts5 A G 16: 85,899,726 I181T probably benign Het
Adamts9 A T 6: 92,880,957 V231D probably damaging Het
Angptl6 C T 9: 20,876,527 V197M probably damaging Het
Atp6v1c1 T C 15: 38,677,528 V99A probably benign Het
Cacna2d3 A G 14: 29,467,949 V110A probably benign Het
Ccdc32 A G 2: 119,019,167 probably benign Het
Cela3b T C 4: 137,428,530 H22R probably benign Het
Cep44 T C 8: 56,540,973 T190A possibly damaging Het
Chsy1 T C 7: 66,171,687 C557R probably damaging Het
Cntd1 A G 11: 101,287,498 T308A probably damaging Het
Cutal T C 2: 34,885,866 probably benign Het
Dgcr14 T C 16: 17,907,555 Y221C probably damaging Het
Dna2 A G 10: 62,956,989 D261G probably damaging Het
Dnhd1 T A 7: 105,693,704 S1418R probably benign Het
Dnpep A G 1: 75,311,778 probably benign Het
Dock7 A T 4: 98,987,479 Y1075N probably benign Het
Eif2s1 C T 12: 78,881,238 probably benign Het
Fam69b A G 2: 26,634,866 T93A probably benign Het
Fer1l6 T C 15: 58,553,724 probably null Het
Gm5592 T C 7: 41,155,830 probably benign Het
Ipp A G 4: 116,537,876 Y536C probably damaging Het
Lamb3 T C 1: 193,332,330 L599P probably damaging Het
Lingo2 T A 4: 35,709,120 T287S probably benign Het
Lipo3 T A 19: 33,559,625 T232S probably benign Het
Lrrc63 G A 14: 75,126,110 H194Y probably benign Het
Map3k13 A G 16: 21,906,524 T416A probably benign Het
Mcm3 A T 1: 20,804,929 probably null Het
Mms22l T C 4: 24,517,223 V258A probably benign Het
Mrpl46 A T 7: 78,782,883 L49* probably null Het
Mrs2 T C 13: 24,993,759 T369A possibly damaging Het
Mtrf1 T A 14: 79,419,268 Y403* probably null Het
Muc20 G A 16: 32,794,480 P176S unknown Het
Mup21 C T 4: 62,150,727 C9Y unknown Het
Mup-ps21 A T 4: 62,030,770 noncoding transcript Het
Mybph T G 1: 134,197,343 probably null Het
Mypn A G 10: 63,134,923 probably benign Het
Nav2 T C 7: 49,408,683 S124P probably damaging Het
Nrros T C 16: 32,143,423 D556G probably damaging Het
Numa1 A C 7: 101,999,677 I872L probably benign Het
Olfr1206 A T 2: 88,864,928 M108L probably benign Het
Olfr13 C T 6: 43,174,004 T6I probably benign Het
Olfr293 A G 7: 86,664,336 I225V possibly damaging Het
Olfr472 T A 7: 107,903,239 I174K probably damaging Het
Olfr92 G C 17: 37,111,455 L176V probably benign Het
Pcdhb9 A T 18: 37,402,255 N434I probably damaging Het
Pigq A T 17: 25,936,762 probably null Het
Plxna2 T G 1: 194,788,837 V972G probably damaging Het
Psma3 G A 12: 70,988,495 probably benign Het
Ptpn13 A G 5: 103,556,109 T1336A probably benign Het
Rdh7 T C 10: 127,884,729 D258G probably benign Het
Serpinb6c A G 13: 33,899,269 I54T probably damaging Het
Sh2d7 A T 9: 54,541,349 Y218F probably benign Het
Slc12a8 A T 16: 33,550,904 I137F possibly damaging Het
Smarca2 T C 19: 26,706,200 V1153A possibly damaging Het
Smc6 A T 12: 11,289,164 I334L probably benign Het
Sorcs1 A G 19: 50,241,942 probably benign Het
Taar8c A G 10: 24,101,503 L137P probably damaging Het
Tcam1 A T 11: 106,285,426 D326V possibly damaging Het
Telo2 A T 17: 25,105,823 V461D probably benign Het
Tmprss7 A T 16: 45,677,962 C351* probably null Het
Trim66 T A 7: 109,454,992 probably benign Het
Ube2d1 G T 10: 71,262,110 H32N probably benign Het
Ubp1 T C 9: 113,964,668 probably benign Het
Vma21 C T X: 71,820,157 T81M probably damaging Het
Vmn1r113 T C 7: 20,787,420 S46P probably benign Het
Wars T C 12: 108,866,018 S374G probably benign Het
Wbp1 T C 6: 83,119,345 D277G possibly damaging Het
Zfp939 C A 7: 39,473,785 noncoding transcript Het
Other mutations in Krt72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Krt72 APN 15 101784999 missense probably damaging 0.99
IGL00568:Krt72 APN 15 101781015 missense probably damaging 1.00
IGL00966:Krt72 APN 15 101780961 missense probably damaging 1.00
IGL01997:Krt72 APN 15 101784880 missense probably damaging 0.99
IGL02858:Krt72 APN 15 101782121 missense probably damaging 1.00
IGL03260:Krt72 APN 15 101778273 missense probably damaging 1.00
R0062:Krt72 UTSW 15 101786008 missense probably damaging 0.98
R0062:Krt72 UTSW 15 101786008 missense probably damaging 0.98
R0601:Krt72 UTSW 15 101786056 missense probably damaging 1.00
R1396:Krt72 UTSW 15 101786005 critical splice donor site probably null
R1501:Krt72 UTSW 15 101778334 missense probably damaging 1.00
R1598:Krt72 UTSW 15 101780253 missense probably benign 0.00
R1779:Krt72 UTSW 15 101780929 missense probably benign
R1796:Krt72 UTSW 15 101781552 splice site probably null
R4259:Krt72 UTSW 15 101778257 missense probably damaging 0.99
R4835:Krt72 UTSW 15 101781073 splice site probably null
R4871:Krt72 UTSW 15 101786034 missense probably damaging 1.00
R6246:Krt72 UTSW 15 101780937 missense probably damaging 1.00
R6513:Krt72 UTSW 15 101776752 critical splice acceptor site probably null
R6520:Krt72 UTSW 15 101781046 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGCCAAACTGTCTTCCACCTTCC -3'
(R):5'- CAGTTCTGTCCAACCTGGACCATC -3'

Sequencing Primer
(F):5'- TTCCTGTTAAAGCAAACACCG -3'
(R):5'- TGGACCATCCAGTAGATCCTG -3'
Posted On2013-07-30