Incidental Mutation 'R0650:Znfx1'
ID62188
Institutional Source Beutler Lab
Gene Symbol Znfx1
Ensembl Gene ENSMUSG00000039501
Gene Namezinc finger, NFX1-type containing 1
Synonyms
MMRRC Submission 038835-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0650 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location167035793-167063015 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 167047654 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 723 (Q723*)
Ref Sequence ENSEMBL: ENSMUSP00000121750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048988] [ENSMUST00000067584] [ENSMUST00000128676] [ENSMUST00000155281]
Predicted Effect probably null
Transcript: ENSMUST00000048988
AA Change: Q723*
SMART Domains Protein: ENSMUSP00000049404
Gene: ENSMUSG00000039501
AA Change: Q723*

DomainStartEndE-ValueType
Pfam:AAA_11 590 855 2.2e-17 PFAM
Pfam:AAA_19 597 684 1.7e-10 PFAM
Pfam:AAA_11 829 1033 1.4e-18 PFAM
Pfam:AAA_12 1044 1228 3.7e-42 PFAM
internal_repeat_2 1281 1374 1.33e-7 PROSPERO
internal_repeat_1 1292 1410 1.32e-16 PROSPERO
low complexity region 1422 1433 N/A INTRINSIC
internal_repeat_1 1434 1547 1.32e-16 PROSPERO
internal_repeat_2 1453 1555 1.33e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000067584
SMART Domains Protein: ENSMUSP00000072867
Gene: ENSMUSG00000039501

DomainStartEndE-ValueType
Pfam:AAA_11 8 170 1.2e-17 PFAM
Pfam:AAA_12 180 364 7.4e-42 PFAM
internal_repeat_2 417 510 1.08e-6 PROSPERO
internal_repeat_1 428 546 1.81e-14 PROSPERO
low complexity region 558 569 N/A INTRINSIC
internal_repeat_1 570 683 1.81e-14 PROSPERO
internal_repeat_2 589 691 1.08e-6 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000128676
AA Change: Q723*
SMART Domains Protein: ENSMUSP00000121598
Gene: ENSMUSG00000039501
AA Change: Q723*

DomainStartEndE-ValueType
Pfam:AAA_11 590 837 1.8e-17 PFAM
Pfam:AAA_19 597 684 3.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135967
Predicted Effect probably null
Transcript: ENSMUST00000155281
AA Change: Q723*
SMART Domains Protein: ENSMUSP00000121750
Gene: ENSMUSG00000039501
AA Change: Q723*

DomainStartEndE-ValueType
Pfam:AAA_11 590 854 1.7e-17 PFAM
Pfam:AAA_19 597 684 3.6e-11 PFAM
Meta Mutation Damage Score 0.6128 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N15Rik A G X: 69,945,785 S96G unknown Het
4930447C04Rik T C 12: 72,910,056 D120G probably damaging Het
4930548H24Rik T C 5: 31,485,968 probably benign Het
Adgrg5 T A 8: 94,934,157 probably null Het
Afg3l2 G T 18: 67,415,557 H534Q possibly damaging Het
Ankar G A 1: 72,656,221 probably benign Het
Arid2 T A 15: 96,402,049 F1814L possibly damaging Het
Asb15 C T 6: 24,566,164 A372V probably damaging Het
Atg16l1 A T 1: 87,781,699 D403V possibly damaging Het
BC024978 A T 7: 27,202,647 H233L probably damaging Het
Bnc2 T C 4: 84,293,196 D407G probably benign Het
Cdan1 A G 2: 120,726,045 V633A probably benign Het
Cfap46 T C 7: 139,605,655 Y2482C unknown Het
Chd8 T C 14: 52,202,304 E964G probably benign Het
Cyp2s1 A G 7: 25,809,258 V253A probably damaging Het
Depdc1b A G 13: 108,323,909 N18D probably damaging Het
Fis1 T A 5: 136,962,194 V4E probably damaging Het
Gba2 T A 4: 43,570,424 probably null Het
Gm2381 C T 7: 42,820,080 G207R probably damaging Het
Gpr89 T A 3: 96,897,324 probably benign Het
Gtf2i A G 5: 134,261,837 probably benign Het
Herc2 T G 7: 56,113,210 S896A probably damaging Het
Huwe1 T C X: 151,876,313 S921P probably damaging Het
Iqgap1 T A 7: 80,736,395 K936I probably damaging Het
Kcna4 T A 2: 107,295,582 Y220* probably null Het
Krt18 A G 15: 102,029,485 D139G possibly damaging Het
Krt83 T C 15: 101,487,040 N392D probably damaging Het
L3mbtl4 G A 17: 68,774,291 C558Y probably damaging Het
Lamc2 T A 1: 153,143,876 I440F possibly damaging Het
Lrrc28 T C 7: 67,618,085 N98S probably damaging Het
Lrrk1 G A 7: 66,292,336 A718V probably damaging Het
Mrgprx2 T C 7: 48,482,918 I51V probably damaging Het
Myt1 A T 2: 181,782,615 R25* probably null Het
Npdc1 C T 2: 25,408,009 T199I probably benign Het
Nup98 T A 7: 102,152,453 Y755F probably damaging Het
Olfr494 T A 7: 108,367,789 C100S probably damaging Het
Olfr502 G T 7: 108,523,082 N289K probably damaging Het
Olfr638 A G 7: 104,003,239 probably null Het
Olfr936 T A 9: 39,046,700 M240L probably benign Het
Osgin1 A T 8: 119,445,472 Y335F probably damaging Het
Pde10a A T 17: 8,942,965 I493F probably damaging Het
Pdgfrb A G 18: 61,079,708 I895V probably benign Het
Peg10 T TCCCCANNANNNN 6: 4,756,475 probably benign Het
Pidd1 A T 7: 141,440,813 L457* probably null Het
Pik3c2a A G 7: 116,346,247 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plcg1 C T 2: 160,753,363 probably benign Het
Prr13 A C 15: 102,462,215 *138C probably null Het
Prrc2b T C 2: 32,229,255 probably benign Het
Psph T C 5: 129,791,570 probably benign Het
Ripor1 A G 8: 105,618,114 probably benign Het
Scg3 A G 9: 75,669,335 S253P probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgk1 A G 10: 21,882,657 N7D probably damaging Het
Skor2 T C 18: 76,876,560 F940L probably benign Het
Slbp T C 5: 33,645,489 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Susd5 A T 9: 114,082,535 H171L possibly damaging Het
Sybu T C 15: 44,673,268 E354G probably benign Het
Synpo T C 18: 60,602,340 N845D possibly damaging Het
Tdrd6 A T 17: 43,628,159 I666N probably damaging Het
Tm9sf4 T C 2: 153,187,365 I111T probably benign Het
Tnc T C 4: 64,008,734 T852A probably benign Het
Tnfrsf10b T A 14: 69,776,176 I185K probably damaging Het
Tnks1bp1 A G 2: 85,062,630 E305G possibly damaging Het
Tnrc6b T C 15: 80,784,758 V22A probably benign Het
Ttn A T 2: 76,768,612 F19319Y probably damaging Het
Ubr5 T C 15: 38,030,807 probably benign Het
Ugt2b5 T A 5: 87,139,768 Q191L probably benign Het
Urod T C 4: 116,991,276 T300A probably benign Het
Vmn1r213 A G 13: 23,011,394 probably benign Het
Other mutations in Znfx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Znfx1 APN 2 167036729 missense possibly damaging 0.65
IGL00492:Znfx1 APN 2 167036923 missense probably damaging 1.00
IGL01285:Znfx1 APN 2 167038695 missense possibly damaging 0.76
IGL01343:Znfx1 APN 2 167037363 missense probably benign 0.16
IGL01767:Znfx1 APN 2 167055723 missense probably damaging 1.00
IGL01983:Znfx1 APN 2 167056350 missense probably damaging 1.00
IGL02006:Znfx1 APN 2 167055763 missense probably damaging 1.00
IGL02254:Znfx1 APN 2 167055723 missense probably damaging 1.00
IGL02421:Znfx1 APN 2 167060080 missense probably damaging 0.97
IGL02496:Znfx1 APN 2 167047630 missense possibly damaging 0.83
IGL02525:Znfx1 APN 2 167037537 missense probably benign 0.00
IGL02528:Znfx1 APN 2 167050404 missense probably benign 0.11
IGL02537:Znfx1 APN 2 167056167 missense probably benign 0.37
IGL03065:Znfx1 APN 2 167055765 missense probably benign 0.00
R0127:Znfx1 UTSW 2 167044210 missense possibly damaging 0.84
R0331:Znfx1 UTSW 2 167046978 missense probably benign 0.11
R0488:Znfx1 UTSW 2 167042563 missense possibly damaging 0.52
R0497:Znfx1 UTSW 2 167055411 missense probably benign 0.03
R0537:Znfx1 UTSW 2 167041701 missense probably damaging 1.00
R0542:Znfx1 UTSW 2 167055655 missense probably damaging 1.00
R0655:Znfx1 UTSW 2 167056907 missense probably damaging 1.00
R1104:Znfx1 UTSW 2 167055640 nonsense probably null
R1470:Znfx1 UTSW 2 167042587 missense possibly damaging 0.91
R1470:Znfx1 UTSW 2 167042587 missense possibly damaging 0.91
R1512:Znfx1 UTSW 2 167056317 missense probably benign 0.03
R1533:Znfx1 UTSW 2 167056788 missense probably benign 0.10
R1541:Znfx1 UTSW 2 167056190 missense probably damaging 0.99
R1642:Znfx1 UTSW 2 167039010 missense possibly damaging 0.95
R1720:Znfx1 UTSW 2 167044066 nonsense probably null
R1760:Znfx1 UTSW 2 167039866 missense probably damaging 0.96
R1865:Znfx1 UTSW 2 167038809 missense probably damaging 1.00
R1959:Znfx1 UTSW 2 167050350 missense probably damaging 1.00
R2088:Znfx1 UTSW 2 167055810 missense probably damaging 1.00
R4581:Znfx1 UTSW 2 167050316 missense probably damaging 1.00
R4622:Znfx1 UTSW 2 167041753 missense possibly damaging 0.91
R4649:Znfx1 UTSW 2 167056356 missense probably benign 0.08
R4685:Znfx1 UTSW 2 167039030 missense probably damaging 1.00
R4798:Znfx1 UTSW 2 167038569 unclassified probably null
R4827:Znfx1 UTSW 2 167044231 missense possibly damaging 0.77
R4870:Znfx1 UTSW 2 167055269 missense probably benign
R4910:Znfx1 UTSW 2 167036804 missense probably damaging 1.00
R4910:Znfx1 UTSW 2 167037482 missense probably benign 0.00
R5022:Znfx1 UTSW 2 167039826 missense probably damaging 1.00
R5023:Znfx1 UTSW 2 167039826 missense probably damaging 1.00
R5057:Znfx1 UTSW 2 167039826 missense probably damaging 1.00
R5061:Znfx1 UTSW 2 167065398 unclassified probably benign
R5119:Znfx1 UTSW 2 167065387 unclassified probably benign
R5125:Znfx1 UTSW 2 167046939 missense possibly damaging 0.81
R5896:Znfx1 UTSW 2 167039000 missense probably damaging 1.00
R6107:Znfx1 UTSW 2 167037081 missense possibly damaging 0.67
R6112:Znfx1 UTSW 2 167038206 missense probably benign
R6158:Znfx1 UTSW 2 167056726 missense probably benign 0.19
R6281:Znfx1 UTSW 2 167055885 missense probably damaging 1.00
R6464:Znfx1 UTSW 2 167046922 missense probably benign 0.34
R6749:Znfx1 UTSW 2 167056599 missense probably benign 0.00
R6888:Znfx1 UTSW 2 167038940 missense possibly damaging 0.91
R6973:Znfx1 UTSW 2 167056761 missense probably benign 0.18
R7017:Znfx1 UTSW 2 167048534 missense probably damaging 1.00
R7138:Znfx1 UTSW 2 167056777 missense probably benign 0.03
X0064:Znfx1 UTSW 2 167055256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCAAACCTAGCAGGTGGAACTG -3'
(R):5'- CCATTGAACGTGAGTCCTTGGGTC -3'

Sequencing Primer
(F):5'- CTGGACTACAACAGCGTCAGG -3'
(R):5'- GGGACCACGGTGTTCTTG -3'
Posted On2013-07-30