Incidental Mutation 'R0650:Sybu'
ID62230
Institutional Source Beutler Lab
Gene Symbol Sybu
Ensembl Gene ENSMUSG00000022340
Gene Namesyntabulin (syntaxin-interacting)
SynonymsA830027B17Rik, Golsyn/Syntabulin, 5730410E15Rik
MMRRC Submission 038835-MU
Accession Numbers

Genbank: NM_176998 ; MGI: 2442392

Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0650 (G1)
Quality Score95
Status Validated
Chromosome15
Chromosomal Location44671856-44788063 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 44673268 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 354 (E354G)
Ref Sequence ENSEMBL: ENSMUSP00000105898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090057] [ENSMUST00000110267] [ENSMUST00000110269] [ENSMUST00000226214] [ENSMUST00000227305] [ENSMUST00000228057]
Predicted Effect probably benign
Transcript: ENSMUST00000090057
AA Change: E554G

PolyPhen 2 Score 0.042 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000087511
Gene: ENSMUSG00000022340
AA Change: E554G

DomainStartEndE-ValueType
low complexity region 51 61 N/A INTRINSIC
low complexity region 112 120 N/A INTRINSIC
low complexity region 148 163 N/A INTRINSIC
low complexity region 174 205 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 276 290 N/A INTRINSIC
low complexity region 320 331 N/A INTRINSIC
Pfam:Syntaphilin 343 638 3.5e-142 PFAM
low complexity region 738 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110267
AA Change: E426G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000105896
Gene: ENSMUSG00000022340
AA Change: E426G

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
low complexity region 46 77 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
low complexity region 148 162 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
Pfam:Syntaphilin 214 511 5.8e-140 PFAM
low complexity region 610 627 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110269
AA Change: E354G

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000105898
Gene: ENSMUSG00000022340
AA Change: E354G

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
low complexity region 120 131 N/A INTRINSIC
Pfam:Syntaphilin 142 439 4.4e-140 PFAM
low complexity region 538 555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226214
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226825
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227081
Predicted Effect probably benign
Transcript: ENSMUST00000227305
AA Change: E425G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000228057
AA Change: E426G

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
Meta Mutation Damage Score 0.0572 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Syntabulin/GOLSYN is part of a kinesin motor-adaptor complex that is critical for the anterograde axonal transport of active zone components and contributes to activity-dependent presynaptic assembly during neuronal development (Cai et al., 2007 [PubMed 17611281]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N15Rik A G X: 69,945,785 S96G unknown Het
4930447C04Rik T C 12: 72,910,056 D120G probably damaging Het
4930548H24Rik T C 5: 31,485,968 probably benign Het
Adgrg5 T A 8: 94,934,157 probably null Het
Afg3l2 G T 18: 67,415,557 H534Q possibly damaging Het
Ankar G A 1: 72,656,221 probably benign Het
Arid2 T A 15: 96,402,049 F1814L possibly damaging Het
Asb15 C T 6: 24,566,164 A372V probably damaging Het
Atg16l1 A T 1: 87,781,699 D403V possibly damaging Het
BC024978 A T 7: 27,202,647 H233L probably damaging Het
Bnc2 T C 4: 84,293,196 D407G probably benign Het
Cdan1 A G 2: 120,726,045 V633A probably benign Het
Cfap46 T C 7: 139,605,655 Y2482C unknown Het
Chd8 T C 14: 52,202,304 E964G probably benign Het
Cyp2s1 A G 7: 25,809,258 V253A probably damaging Het
Depdc1b A G 13: 108,323,909 N18D probably damaging Het
Fis1 T A 5: 136,962,194 V4E probably damaging Het
Gba2 T A 4: 43,570,424 probably null Het
Gm2381 C T 7: 42,820,080 G207R probably damaging Het
Gpr89 T A 3: 96,897,324 probably benign Het
Gtf2i A G 5: 134,261,837 probably benign Het
Herc2 T G 7: 56,113,210 S896A probably damaging Het
Huwe1 T C X: 151,876,313 S921P probably damaging Het
Iqgap1 T A 7: 80,736,395 K936I probably damaging Het
Kcna4 T A 2: 107,295,582 Y220* probably null Het
Krt18 A G 15: 102,029,485 D139G possibly damaging Het
Krt83 T C 15: 101,487,040 N392D probably damaging Het
L3mbtl4 G A 17: 68,774,291 C558Y probably damaging Het
Lamc2 T A 1: 153,143,876 I440F possibly damaging Het
Lrrc28 T C 7: 67,618,085 N98S probably damaging Het
Lrrk1 G A 7: 66,292,336 A718V probably damaging Het
Mrgprx2 T C 7: 48,482,918 I51V probably damaging Het
Myt1 A T 2: 181,782,615 R25* probably null Het
Npdc1 C T 2: 25,408,009 T199I probably benign Het
Nup98 T A 7: 102,152,453 Y755F probably damaging Het
Olfr494 T A 7: 108,367,789 C100S probably damaging Het
Olfr502 G T 7: 108,523,082 N289K probably damaging Het
Olfr638 A G 7: 104,003,239 probably null Het
Olfr936 T A 9: 39,046,700 M240L probably benign Het
Osgin1 A T 8: 119,445,472 Y335F probably damaging Het
Pde10a A T 17: 8,942,965 I493F probably damaging Het
Pdgfrb A G 18: 61,079,708 I895V probably benign Het
Peg10 T TCCCCANNANNNN 6: 4,756,475 probably benign Het
Pidd1 A T 7: 141,440,813 L457* probably null Het
Pik3c2a A G 7: 116,346,247 probably benign Het
Pkd1l3 C G 8: 109,623,649 D375E possibly damaging Het
Plcg1 C T 2: 160,753,363 probably benign Het
Prr13 A C 15: 102,462,215 *138C probably null Het
Prrc2b T C 2: 32,229,255 probably benign Het
Psph T C 5: 129,791,570 probably benign Het
Ripor1 A G 8: 105,618,114 probably benign Het
Scg3 A G 9: 75,669,335 S253P probably damaging Het
Sema6a G A 18: 47,290,045 probably null Het
Sgk1 A G 10: 21,882,657 N7D probably damaging Het
Skor2 T C 18: 76,876,560 F940L probably benign Het
Slbp T C 5: 33,645,489 probably benign Het
Snrnp40 C G 4: 130,378,043 probably null Het
Susd5 A T 9: 114,082,535 H171L possibly damaging Het
Synpo T C 18: 60,602,340 N845D possibly damaging Het
Tdrd6 A T 17: 43,628,159 I666N probably damaging Het
Tm9sf4 T C 2: 153,187,365 I111T probably benign Het
Tnc T C 4: 64,008,734 T852A probably benign Het
Tnfrsf10b T A 14: 69,776,176 I185K probably damaging Het
Tnks1bp1 A G 2: 85,062,630 E305G possibly damaging Het
Tnrc6b T C 15: 80,784,758 V22A probably benign Het
Ttn A T 2: 76,768,612 F19319Y probably damaging Het
Ubr5 T C 15: 38,030,807 probably benign Het
Ugt2b5 T A 5: 87,139,768 Q191L probably benign Het
Urod T C 4: 116,991,276 T300A probably benign Het
Vmn1r213 A G 13: 23,011,394 probably benign Het
Znfx1 G A 2: 167,047,654 Q723* probably null Het
Other mutations in Sybu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01453:Sybu APN 15 44672805 missense probably damaging 1.00
IGL02211:Sybu APN 15 44673466 missense probably damaging 1.00
IGL02303:Sybu APN 15 44673223 missense probably benign 0.03
E7848:Sybu UTSW 15 44673422 missense probably benign 0.32
R0015:Sybu UTSW 15 44673500 missense probably damaging 0.99
R0015:Sybu UTSW 15 44673500 missense probably damaging 0.99
R0064:Sybu UTSW 15 44672993 missense probably benign 0.00
R0064:Sybu UTSW 15 44672993 missense probably benign 0.00
R0413:Sybu UTSW 15 44673272 missense probably damaging 1.00
R1147:Sybu UTSW 15 44746255 missense probably damaging 1.00
R1147:Sybu UTSW 15 44746255 missense probably damaging 1.00
R1307:Sybu UTSW 15 44675390 missense probably damaging 1.00
R1568:Sybu UTSW 15 44718832 nonsense probably null
R2112:Sybu UTSW 15 44673335 missense probably benign 0.06
R2967:Sybu UTSW 15 44746356 missense probably damaging 1.00
R3120:Sybu UTSW 15 44672959 missense possibly damaging 0.88
R3429:Sybu UTSW 15 44746458 missense probably damaging 0.98
R3508:Sybu UTSW 15 44673082 missense probably damaging 1.00
R3720:Sybu UTSW 15 44672632 missense possibly damaging 0.89
R4080:Sybu UTSW 15 44718943 missense probably damaging 1.00
R4898:Sybu UTSW 15 44675499 missense probably benign 0.02
R4975:Sybu UTSW 15 44677667 missense probably damaging 1.00
R5066:Sybu UTSW 15 44677644 missense probably damaging 1.00
R5783:Sybu UTSW 15 44746414 missense probably damaging 0.96
R5913:Sybu UTSW 15 44787621 missense probably damaging 1.00
R6977:Sybu UTSW 15 44677695 missense probably benign 0.00
R7044:Sybu UTSW 15 44677695 missense possibly damaging 0.79
R7139:Sybu UTSW 15 44677714 missense possibly damaging 0.93
R7328:Sybu UTSW 15 44787794 missense not run
R7543:Sybu UTSW 15 44683452 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGCGATTTGCATGGGCTTCCATAG -3'
(R):5'- GCTTCAAAGCATGGAGATGGCACAC -3'

Sequencing Primer
(F):5'- GCAGCTTTAGCACACTCTGAATG -3'
(R):5'- CACACAATAGTTCCCTGAGGGATG -3'
Posted On2013-07-30