Incidental Mutation 'R0652:Ncoa6'
ID62270
Institutional Source Beutler Lab
Gene Symbol Ncoa6
Ensembl Gene ENSMUSG00000038369
Gene Namenuclear receptor coactivator 6
SynonymsPRIP, ASC-2, NRC, AIB3, RAP250, ASC2
MMRRC Submission 038837-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0652 (G1)
Quality Score115
Status Not validated
Chromosome2
Chromosomal Location155390656-155473894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 155391211 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 2059 (G2059D)
Ref Sequence ENSEMBL: ENSMUSP00000105295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043126] [ENSMUST00000043237] [ENSMUST00000109670] [ENSMUST00000174685]
Predicted Effect probably benign
Transcript: ENSMUST00000043126
AA Change: G2059D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000045386
Gene: ENSMUSG00000038369
AA Change: G2059D

DomainStartEndE-ValueType
Pfam:Nucleic_acid_bd 47 190 3.3e-55 PFAM
coiled coil region 256 296 N/A INTRINSIC
low complexity region 375 383 N/A INTRINSIC
internal_repeat_1 450 597 3.31e-5 PROSPERO
low complexity region 615 630 N/A INTRINSIC
internal_repeat_1 636 793 3.31e-5 PROSPERO
low complexity region 844 860 N/A INTRINSIC
low complexity region 909 931 N/A INTRINSIC
low complexity region 986 998 N/A INTRINSIC
low complexity region 1002 1046 N/A INTRINSIC
low complexity region 1126 1139 N/A INTRINSIC
low complexity region 1258 1273 N/A INTRINSIC
low complexity region 1328 1351 N/A INTRINSIC
low complexity region 1543 1564 N/A INTRINSIC
low complexity region 1578 1599 N/A INTRINSIC
low complexity region 1607 1618 N/A INTRINSIC
low complexity region 1808 1825 N/A INTRINSIC
low complexity region 1894 1908 N/A INTRINSIC
low complexity region 2043 2053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043237
SMART Domains Protein: ENSMUSP00000037627
Gene: ENSMUSG00000038375

DomainStartEndE-ValueType
Pfam:DOR 50 217 5.5e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109670
AA Change: G2059D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105295
Gene: ENSMUSG00000038369
AA Change: G2059D

DomainStartEndE-ValueType
Pfam:Nucleic_acid_bd 45 195 3.6e-60 PFAM
coiled coil region 256 296 N/A INTRINSIC
low complexity region 375 383 N/A INTRINSIC
internal_repeat_1 450 597 3.31e-5 PROSPERO
low complexity region 615 630 N/A INTRINSIC
internal_repeat_1 636 793 3.31e-5 PROSPERO
low complexity region 844 860 N/A INTRINSIC
low complexity region 909 931 N/A INTRINSIC
low complexity region 986 998 N/A INTRINSIC
low complexity region 1002 1046 N/A INTRINSIC
low complexity region 1126 1139 N/A INTRINSIC
low complexity region 1258 1273 N/A INTRINSIC
low complexity region 1328 1351 N/A INTRINSIC
low complexity region 1543 1564 N/A INTRINSIC
low complexity region 1578 1599 N/A INTRINSIC
low complexity region 1607 1618 N/A INTRINSIC
low complexity region 1808 1825 N/A INTRINSIC
low complexity region 1894 1908 N/A INTRINSIC
low complexity region 2043 2053 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146942
Predicted Effect probably benign
Transcript: ENSMUST00000174685
SMART Domains Protein: ENSMUSP00000133880
Gene: ENSMUSG00000038375

DomainStartEndE-ValueType
Pfam:DOR 42 170 2.3e-37 PFAM
Meta Mutation Damage Score 0.1212 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.3%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit retarded embryonic growth and defects of the placenta, heart, liver, and nervous system. Mutants die around midgestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,152,063 N387D probably benign Het
Adgrg5 T A 8: 94,934,157 probably null Het
Ahi1 C A 10: 20,979,461 H556Q probably damaging Het
Amph A G 13: 19,086,621 probably null Het
Apol7a T C 15: 77,389,855 probably benign Het
Apoo-ps A T 13: 107,414,410 noncoding transcript Het
Arpc1b A G 5: 145,126,860 D306G probably damaging Het
Astn2 T C 4: 65,794,558 D615G probably damaging Het
Atm A G 9: 53,486,014 V1673A probably damaging Het
B3gnt3 A T 8: 71,693,822 V21E probably benign Het
Bco1 A G 8: 117,105,696 D77G probably damaging Het
Brinp2 A T 1: 158,246,621 H643Q probably damaging Het
Bsn A G 9: 108,105,742 F3604S unknown Het
Cacna1c A G 6: 118,602,229 F1753L probably damaging Het
Cd74 T C 18: 60,811,885 S201P probably damaging Het
Cep192 T A 18: 67,807,265 L101Q probably benign Het
Cfap161 T C 7: 83,793,276 I110V probably null Het
Cnksr3 T C 10: 7,120,463 D257G probably damaging Het
Col14a1 A C 15: 55,344,882 E121A unknown Het
Cpne3 T C 4: 19,532,486 D309G probably benign Het
Ctnnd1 A G 2: 84,602,896 I609T probably benign Het
Cyp2s1 A G 7: 25,809,258 V253A probably damaging Het
Dock7 T C 4: 99,055,349 D552G possibly damaging Het
Dpyd A G 3: 119,427,275 D965G probably damaging Het
Efcab2 T A 1: 178,481,346 M138K probably damaging Het
Eml3 T C 19: 8,933,285 S204P probably damaging Het
Fbxw16 T A 9: 109,436,168 S432C possibly damaging Het
Fbxw20 T G 9: 109,232,332 Q116H probably damaging Het
Fech A G 18: 64,458,169 S395P probably damaging Het
Fgf7 A G 2: 126,035,955 K81E probably benign Het
Fras1 T A 5: 96,781,340 Y3868N possibly damaging Het
Ganab A T 19: 8,915,402 probably null Het
Gfra1 T C 19: 58,300,554 N153S possibly damaging Het
Gja4 T A 4: 127,312,127 Y281F probably benign Het
Gm15448 T A 7: 3,822,763 Y369F probably benign Het
Gm4763 T A 7: 24,724,197 N14I possibly damaging Het
Gm5141 T C 13: 62,774,132 T407A probably damaging Het
Gm5422 T C 10: 31,249,281 noncoding transcript Het
Greb1 T C 12: 16,696,456 Y1271C probably damaging Het
Hp1bp3 C A 4: 138,228,769 N50K possibly damaging Het
Hspg2 T C 4: 137,514,722 F589S probably damaging Het
Ido1 A G 8: 24,585,244 F183S probably damaging Het
Iqgap1 T A 7: 80,736,395 K936I probably damaging Het
Kdm4a T C 4: 118,175,689 D60G probably benign Het
L3mbtl4 G A 17: 68,774,291 C558Y probably damaging Het
Lrrc28 T C 7: 67,618,085 N98S probably damaging Het
Map1a A G 2: 121,302,783 D1360G probably benign Het
Megf10 C T 18: 57,277,724 P702S probably benign Het
Met A G 6: 17,491,710 E157G probably benign Het
Mff A G 1: 82,750,564 D187G possibly damaging Het
Mlph A T 1: 90,942,908 I514F possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Myo15b T C 11: 115,864,642 V976A probably benign Het
Myo9a A G 9: 59,871,926 D1655G probably benign Het
Ndst4 A T 3: 125,611,539 H481L possibly damaging Het
Nipbl A G 15: 8,303,480 S2220P probably benign Het
Nom1 C A 5: 29,435,311 P212T probably damaging Het
Nsd1 A G 13: 55,247,586 D1000G possibly damaging Het
Nudt9 T C 5: 104,050,601 F44S possibly damaging Het
Numb C T 12: 83,795,792 V537I probably damaging Het
Olfr1404 T A 1: 173,215,957 I102N possibly damaging Het
Olfr1463 A T 19: 13,234,535 Y95F possibly damaging Het
Olfr183 A G 16: 58,999,700 N5S probably damaging Het
Olfr60 A T 7: 140,345,632 M119K probably damaging Het
Olfr638 A G 7: 104,003,239 probably null Het
Olfr801 T A 10: 129,670,379 T47S probably benign Het
Osgin1 A T 8: 119,445,472 Y335F probably damaging Het
Pcdh10 T A 3: 45,379,764 V171E probably damaging Het
Plxna4 T C 6: 32,185,501 N1359S probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prr5l T C 2: 101,772,290 T2A possibly damaging Het
Rbp3 T A 14: 33,958,648 I1069N possibly damaging Het
Rnf144b A G 13: 47,220,507 Y60C probably damaging Het
Sbno2 A T 10: 80,067,294 V396E probably damaging Het
Sdk1 A G 5: 141,954,958 T494A probably benign Het
Serac1 G T 17: 6,051,756 D384E probably damaging Het
Sgk1 A G 10: 21,882,657 N7D probably damaging Het
Sigirr A T 7: 141,093,067 V69D possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
St6gal2 T C 17: 55,498,289 Y396H probably benign Het
Ttn A T 2: 76,768,612 F19319Y probably damaging Het
Ubr4 T A 4: 139,401,326 I599N probably damaging Het
Vmn1r213 A G 13: 23,011,394 probably benign Het
Vmn2r96 T A 17: 18,597,568 M469K probably benign Het
Wasf1 T A 10: 40,931,906 probably null Het
Wdr20rt T C 12: 65,225,915 S51P probably damaging Het
Other mutations in Ncoa6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Ncoa6 APN 2 155406208 missense probably damaging 0.99
IGL00849:Ncoa6 APN 2 155421688 missense possibly damaging 0.89
IGL00933:Ncoa6 APN 2 155415397 missense probably damaging 1.00
IGL00981:Ncoa6 APN 2 155406179 missense probably damaging 0.98
IGL01420:Ncoa6 APN 2 155407587 missense probably damaging 1.00
IGL02160:Ncoa6 APN 2 155421083 missense possibly damaging 0.65
IGL03049:Ncoa6 APN 2 155419014 missense probably damaging 1.00
IGL03194:Ncoa6 APN 2 155415868 missense possibly damaging 0.94
IGL03269:Ncoa6 APN 2 155406489 missense probably damaging 0.97
IGL03299:Ncoa6 APN 2 155407287 missense probably damaging 0.97
IGL03306:Ncoa6 APN 2 155405507 missense probably benign 0.30
alcoa UTSW 2 155402664 unclassified probably benign
Aluminum UTSW 2 155399693 critical splice acceptor site probably null
balboa UTSW 2 155406949 missense probably benign 0.05
mauna_loa UTSW 2 155415227 missense probably damaging 0.99
PIT4466001:Ncoa6 UTSW 2 155405657 missense probably benign
R0011:Ncoa6 UTSW 2 155408291 frame shift probably null
R0014:Ncoa6 UTSW 2 155438043 missense possibly damaging 0.86
R0079:Ncoa6 UTSW 2 155408291 frame shift probably null
R0080:Ncoa6 UTSW 2 155408291 frame shift probably null
R0081:Ncoa6 UTSW 2 155408291 frame shift probably null
R0164:Ncoa6 UTSW 2 155408291 frame shift probably null
R0166:Ncoa6 UTSW 2 155408291 frame shift probably null
R0172:Ncoa6 UTSW 2 155408291 frame shift probably null
R0173:Ncoa6 UTSW 2 155408291 frame shift probably null
R0245:Ncoa6 UTSW 2 155391211 missense probably benign 0.00
R0284:Ncoa6 UTSW 2 155408291 frame shift probably null
R0285:Ncoa6 UTSW 2 155408291 frame shift probably null
R0285:Ncoa6 UTSW 2 155415701 missense probably damaging 0.96
R0288:Ncoa6 UTSW 2 155408291 frame shift probably null
R0539:Ncoa6 UTSW 2 155415697 missense probably benign 0.08
R0781:Ncoa6 UTSW 2 155411520 splice site probably benign
R1053:Ncoa6 UTSW 2 155434040 missense probably damaging 1.00
R1110:Ncoa6 UTSW 2 155411520 splice site probably benign
R1420:Ncoa6 UTSW 2 155421153 nonsense probably null
R1521:Ncoa6 UTSW 2 155415222 missense possibly damaging 0.78
R1541:Ncoa6 UTSW 2 155415304 missense probably benign 0.35
R1677:Ncoa6 UTSW 2 155402664 unclassified probably benign
R1858:Ncoa6 UTSW 2 155421639 missense probably benign 0.13
R1954:Ncoa6 UTSW 2 155406821 missense possibly damaging 0.94
R1955:Ncoa6 UTSW 2 155406821 missense possibly damaging 0.94
R2040:Ncoa6 UTSW 2 155406080 missense probably damaging 0.98
R2087:Ncoa6 UTSW 2 155406159 nonsense probably null
R2159:Ncoa6 UTSW 2 155407713 missense probably damaging 1.00
R2278:Ncoa6 UTSW 2 155407650 missense possibly damaging 0.94
R2696:Ncoa6 UTSW 2 155438015 missense probably benign 0.45
R2891:Ncoa6 UTSW 2 155437961 missense possibly damaging 0.86
R3618:Ncoa6 UTSW 2 155407789 missense possibly damaging 0.95
R3747:Ncoa6 UTSW 2 155411641 missense probably benign 0.01
R3778:Ncoa6 UTSW 2 155421195 missense probably damaging 1.00
R3784:Ncoa6 UTSW 2 155407757 missense probably damaging 1.00
R3802:Ncoa6 UTSW 2 155405564 missense probably benign
R3820:Ncoa6 UTSW 2 155406938 missense probably damaging 1.00
R3821:Ncoa6 UTSW 2 155406938 missense probably damaging 1.00
R3822:Ncoa6 UTSW 2 155406938 missense probably damaging 1.00
R3870:Ncoa6 UTSW 2 155415557 unclassified probably null
R4037:Ncoa6 UTSW 2 155407370 missense probably damaging 0.98
R4488:Ncoa6 UTSW 2 155407476 missense possibly damaging 0.94
R4719:Ncoa6 UTSW 2 155391161 unclassified probably benign
R4732:Ncoa6 UTSW 2 155421301 missense probably damaging 1.00
R4733:Ncoa6 UTSW 2 155421301 missense probably damaging 1.00
R4829:Ncoa6 UTSW 2 155415227 missense probably damaging 0.99
R4835:Ncoa6 UTSW 2 155407133 missense possibly damaging 0.46
R4883:Ncoa6 UTSW 2 155406767 missense probably benign 0.29
R4967:Ncoa6 UTSW 2 155421332 missense possibly damaging 0.80
R5021:Ncoa6 UTSW 2 155406949 missense probably benign 0.05
R5234:Ncoa6 UTSW 2 155438013 missense probably benign 0.01
R5356:Ncoa6 UTSW 2 155421192 missense probably damaging 0.99
R5358:Ncoa6 UTSW 2 155406987 missense probably damaging 0.97
R5375:Ncoa6 UTSW 2 155433995 missense probably benign 0.16
R5412:Ncoa6 UTSW 2 155407781 missense possibly damaging 0.95
R5579:Ncoa6 UTSW 2 155406677 missense probably damaging 1.00
R5618:Ncoa6 UTSW 2 155437897 missense possibly damaging 0.86
R5641:Ncoa6 UTSW 2 155421836 missense probably benign 0.22
R5757:Ncoa6 UTSW 2 155411608 missense probably damaging 1.00
R5761:Ncoa6 UTSW 2 155408141 missense probably benign 0.11
R5778:Ncoa6 UTSW 2 155406768 missense probably benign 0.01
R5852:Ncoa6 UTSW 2 155405499 missense possibly damaging 0.88
R5940:Ncoa6 UTSW 2 155415865 missense probably damaging 0.98
R6155:Ncoa6 UTSW 2 155407448 missense probably damaging 1.00
R6374:Ncoa6 UTSW 2 155421156 missense probably damaging 1.00
R6389:Ncoa6 UTSW 2 155395816 missense probably damaging 0.98
R6669:Ncoa6 UTSW 2 155399693 critical splice acceptor site probably null
R7097:Ncoa6 UTSW 2 155438063 missense probably benign 0.01
R7385:Ncoa6 UTSW 2 155407801 missense probably damaging 1.00
X0017:Ncoa6 UTSW 2 155406540 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GGGCTGCTCCCCGTTAAACTTTATG -3'
(R):5'- ATCACATTTCCCCACTTGGCAGGC -3'

Sequencing Primer
(F):5'- CCCCGTTAAACTTTATGAGACAGG -3'
(R):5'- CACTTGGCAGGCTCTAGTATCAG -3'
Posted On2013-07-30