Incidental Mutation 'R0652:Wasf1'
ID62315
Institutional Source Beutler Lab
Gene Symbol Wasf1
Ensembl Gene ENSMUSG00000019831
Gene NameWAS protein family, member 1
SynonymsWAVE-1, Scar, WAVE
MMRRC Submission 038837-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.486) question?
Stock #R0652 (G1)
Quality Score112
Status Not validated
Chromosome10
Chromosomal Location40883475-40938570 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 40931906 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000101148 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019975] [ENSMUST00000105509]
Predicted Effect probably null
Transcript: ENSMUST00000019975
SMART Domains Protein: ENSMUSP00000019975
Gene: ENSMUSG00000019831

DomainStartEndE-ValueType
PDB:4N78|D 1 320 N/A PDB
low complexity region 321 401 N/A INTRINSIC
low complexity region 423 435 N/A INTRINSIC
low complexity region 462 482 N/A INTRINSIC
WH2 497 514 4.32e-5 SMART
low complexity region 544 556 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105509
SMART Domains Protein: ENSMUSP00000101148
Gene: ENSMUSG00000019831

DomainStartEndE-ValueType
PDB:4N78|D 1 320 N/A PDB
low complexity region 321 401 N/A INTRINSIC
low complexity region 423 435 N/A INTRINSIC
low complexity region 462 482 N/A INTRINSIC
WH2 497 514 4.32e-5 SMART
low complexity region 544 556 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.3%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, a member of the Wiskott-Aldrich syndrome protein (WASP)-family, plays a critical role downstream of Rac, a Rho-family small GTPase, in regulating the actin cytoskeleton required for membrane ruffling. It has been shown to associate with an actin nucleation core Arp2/3 complex while enhancing actin polymerization in vitro. Wiskott-Aldrich syndrome is a disease of the immune system, likely due to defects in regulation of actin cytoskeleton. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutation of this gene has been associated with both morphological and functional defects of the central nervous system. Targeted mutagenesis has resulted in mice that display sensorimotor and cognitive defects similar to those exhibited by patients with 3p-syndrome mental retardation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,152,063 N387D probably benign Het
Adgrg5 T A 8: 94,934,157 probably null Het
Ahi1 C A 10: 20,979,461 H556Q probably damaging Het
Amph A G 13: 19,086,621 probably null Het
Apol7a T C 15: 77,389,855 probably benign Het
Apoo-ps A T 13: 107,414,410 noncoding transcript Het
Arpc1b A G 5: 145,126,860 D306G probably damaging Het
Astn2 T C 4: 65,794,558 D615G probably damaging Het
Atm A G 9: 53,486,014 V1673A probably damaging Het
B3gnt3 A T 8: 71,693,822 V21E probably benign Het
Bco1 A G 8: 117,105,696 D77G probably damaging Het
Brinp2 A T 1: 158,246,621 H643Q probably damaging Het
Bsn A G 9: 108,105,742 F3604S unknown Het
Cacna1c A G 6: 118,602,229 F1753L probably damaging Het
Cd74 T C 18: 60,811,885 S201P probably damaging Het
Cep192 T A 18: 67,807,265 L101Q probably benign Het
Cfap161 T C 7: 83,793,276 I110V probably null Het
Cnksr3 T C 10: 7,120,463 D257G probably damaging Het
Col14a1 A C 15: 55,344,882 E121A unknown Het
Cpne3 T C 4: 19,532,486 D309G probably benign Het
Ctnnd1 A G 2: 84,602,896 I609T probably benign Het
Cyp2s1 A G 7: 25,809,258 V253A probably damaging Het
Dock7 T C 4: 99,055,349 D552G possibly damaging Het
Dpyd A G 3: 119,427,275 D965G probably damaging Het
Efcab2 T A 1: 178,481,346 M138K probably damaging Het
Eml3 T C 19: 8,933,285 S204P probably damaging Het
Fbxw16 T A 9: 109,436,168 S432C possibly damaging Het
Fbxw20 T G 9: 109,232,332 Q116H probably damaging Het
Fech A G 18: 64,458,169 S395P probably damaging Het
Fgf7 A G 2: 126,035,955 K81E probably benign Het
Fras1 T A 5: 96,781,340 Y3868N possibly damaging Het
Ganab A T 19: 8,915,402 probably null Het
Gfra1 T C 19: 58,300,554 N153S possibly damaging Het
Gja4 T A 4: 127,312,127 Y281F probably benign Het
Gm15448 T A 7: 3,822,763 Y369F probably benign Het
Gm4763 T A 7: 24,724,197 N14I possibly damaging Het
Gm5141 T C 13: 62,774,132 T407A probably damaging Het
Gm5422 T C 10: 31,249,281 noncoding transcript Het
Greb1 T C 12: 16,696,456 Y1271C probably damaging Het
Hp1bp3 C A 4: 138,228,769 N50K possibly damaging Het
Hspg2 T C 4: 137,514,722 F589S probably damaging Het
Ido1 A G 8: 24,585,244 F183S probably damaging Het
Iqgap1 T A 7: 80,736,395 K936I probably damaging Het
Kdm4a T C 4: 118,175,689 D60G probably benign Het
L3mbtl4 G A 17: 68,774,291 C558Y probably damaging Het
Lrrc28 T C 7: 67,618,085 N98S probably damaging Het
Map1a A G 2: 121,302,783 D1360G probably benign Het
Megf10 C T 18: 57,277,724 P702S probably benign Het
Met A G 6: 17,491,710 E157G probably benign Het
Mff A G 1: 82,750,564 D187G possibly damaging Het
Mlph A T 1: 90,942,908 I514F possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Myo15b T C 11: 115,864,642 V976A probably benign Het
Myo9a A G 9: 59,871,926 D1655G probably benign Het
Ncoa6 C T 2: 155,391,211 G2059D probably benign Het
Ndst4 A T 3: 125,611,539 H481L possibly damaging Het
Nipbl A G 15: 8,303,480 S2220P probably benign Het
Nom1 C A 5: 29,435,311 P212T probably damaging Het
Nsd1 A G 13: 55,247,586 D1000G possibly damaging Het
Nudt9 T C 5: 104,050,601 F44S possibly damaging Het
Numb C T 12: 83,795,792 V537I probably damaging Het
Olfr1404 T A 1: 173,215,957 I102N possibly damaging Het
Olfr1463 A T 19: 13,234,535 Y95F possibly damaging Het
Olfr183 A G 16: 58,999,700 N5S probably damaging Het
Olfr60 A T 7: 140,345,632 M119K probably damaging Het
Olfr638 A G 7: 104,003,239 probably null Het
Olfr801 T A 10: 129,670,379 T47S probably benign Het
Osgin1 A T 8: 119,445,472 Y335F probably damaging Het
Pcdh10 T A 3: 45,379,764 V171E probably damaging Het
Plxna4 T C 6: 32,185,501 N1359S probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prr5l T C 2: 101,772,290 T2A possibly damaging Het
Rbp3 T A 14: 33,958,648 I1069N possibly damaging Het
Rnf144b A G 13: 47,220,507 Y60C probably damaging Het
Sbno2 A T 10: 80,067,294 V396E probably damaging Het
Sdk1 A G 5: 141,954,958 T494A probably benign Het
Serac1 G T 17: 6,051,756 D384E probably damaging Het
Sgk1 A G 10: 21,882,657 N7D probably damaging Het
Sigirr A T 7: 141,093,067 V69D possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
St6gal2 T C 17: 55,498,289 Y396H probably benign Het
Ttn A T 2: 76,768,612 F19319Y probably damaging Het
Ubr4 T A 4: 139,401,326 I599N probably damaging Het
Vmn1r213 A G 13: 23,011,394 probably benign Het
Vmn2r96 T A 17: 18,597,568 M469K probably benign Het
Wdr20rt T C 12: 65,225,915 S51P probably damaging Het
Other mutations in Wasf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Wasf1 APN 10 40920297 missense probably damaging 1.00
IGL01978:Wasf1 APN 10 40936201 missense unknown
IGL02265:Wasf1 APN 10 40936441 missense unknown
IGL02565:Wasf1 APN 10 40936132 missense possibly damaging 0.70
IGL02741:Wasf1 APN 10 40930709 missense probably damaging 1.00
IGL03037:Wasf1 APN 10 40930658 missense probably benign 0.42
potatoes UTSW 10 40926620 critical splice donor site probably null
K3955:Wasf1 UTSW 10 40936195 missense unknown
R1276:Wasf1 UTSW 10 40936526 missense unknown
R1774:Wasf1 UTSW 10 40934479 missense possibly damaging 0.50
R1813:Wasf1 UTSW 10 40926589 missense probably damaging 1.00
R3607:Wasf1 UTSW 10 40936384 missense unknown
R4418:Wasf1 UTSW 10 40936582 missense unknown
R4952:Wasf1 UTSW 10 40936190 missense unknown
R4997:Wasf1 UTSW 10 40934604 missense probably damaging 0.96
R5178:Wasf1 UTSW 10 40937676 missense unknown
R5718:Wasf1 UTSW 10 40926574 missense probably damaging 1.00
R5789:Wasf1 UTSW 10 40926574 missense probably damaging 1.00
R5791:Wasf1 UTSW 10 40926574 missense probably damaging 1.00
R5839:Wasf1 UTSW 10 40936319 missense unknown
R6247:Wasf1 UTSW 10 40937745 missense unknown
R6688:Wasf1 UTSW 10 40926620 critical splice donor site probably null
R6889:Wasf1 UTSW 10 40920369 missense probably damaging 1.00
R6977:Wasf1 UTSW 10 40926585 missense probably damaging 0.97
R7023:Wasf1 UTSW 10 40936475 missense unknown
R7136:Wasf1 UTSW 10 40926591 missense possibly damaging 0.91
R7224:Wasf1 UTSW 10 40926550 missense probably benign 0.17
X0025:Wasf1 UTSW 10 40936697 missense unknown
X0067:Wasf1 UTSW 10 40937657 missense unknown
Predicted Primers PCR Primer
(F):5'- AAGCGATGCTCCTGCTTTCCAGAC -3'
(R):5'- AGGGCTGCCAAAGTGCAGATTAAC -3'

Sequencing Primer
(F):5'- CCTACAGTTGGGCAACAGTG -3'
(R):5'- GTGCAGATTAACAGCGTTTCCAG -3'
Posted On2013-07-30