Incidental Mutation 'R0652:Olfr1463'
ID62349
Institutional Source Beutler Lab
Gene Symbol Olfr1463
Ensembl Gene ENSMUSG00000096365
Gene Nameolfactory receptor 1463
SynonymsMOR202-29P, GA_x6K02T2RE5P-3560863-3561795
MMRRC Submission 038837-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R0652 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13231328-13236400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13234535 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 95 (Y95F)
Ref Sequence ENSEMBL: ENSMUSP00000146566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064102] [ENSMUST00000207246]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064102
AA Change: Y95F

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000070872
Gene: ENSMUSG00000096365
AA Change: Y95F

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 1e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 306 3.2e-6 PFAM
Pfam:7tm_1 42 291 1.4e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207246
AA Change: Y95F

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.3%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,152,063 N387D probably benign Het
Adgrg5 T A 8: 94,934,157 probably null Het
Ahi1 C A 10: 20,979,461 H556Q probably damaging Het
Amph A G 13: 19,086,621 probably null Het
Apol7a T C 15: 77,389,855 probably benign Het
Apoo-ps A T 13: 107,414,410 noncoding transcript Het
Arpc1b A G 5: 145,126,860 D306G probably damaging Het
Astn2 T C 4: 65,794,558 D615G probably damaging Het
Atm A G 9: 53,486,014 V1673A probably damaging Het
B3gnt3 A T 8: 71,693,822 V21E probably benign Het
Bco1 A G 8: 117,105,696 D77G probably damaging Het
Brinp2 A T 1: 158,246,621 H643Q probably damaging Het
Bsn A G 9: 108,105,742 F3604S unknown Het
Cacna1c A G 6: 118,602,229 F1753L probably damaging Het
Cd74 T C 18: 60,811,885 S201P probably damaging Het
Cep192 T A 18: 67,807,265 L101Q probably benign Het
Cfap161 T C 7: 83,793,276 I110V probably null Het
Cnksr3 T C 10: 7,120,463 D257G probably damaging Het
Col14a1 A C 15: 55,344,882 E121A unknown Het
Cpne3 T C 4: 19,532,486 D309G probably benign Het
Ctnnd1 A G 2: 84,602,896 I609T probably benign Het
Cyp2s1 A G 7: 25,809,258 V253A probably damaging Het
Dock7 T C 4: 99,055,349 D552G possibly damaging Het
Dpyd A G 3: 119,427,275 D965G probably damaging Het
Efcab2 T A 1: 178,481,346 M138K probably damaging Het
Eml3 T C 19: 8,933,285 S204P probably damaging Het
Fbxw16 T A 9: 109,436,168 S432C possibly damaging Het
Fbxw20 T G 9: 109,232,332 Q116H probably damaging Het
Fech A G 18: 64,458,169 S395P probably damaging Het
Fgf7 A G 2: 126,035,955 K81E probably benign Het
Fras1 T A 5: 96,781,340 Y3868N possibly damaging Het
Ganab A T 19: 8,915,402 probably null Het
Gfra1 T C 19: 58,300,554 N153S possibly damaging Het
Gja4 T A 4: 127,312,127 Y281F probably benign Het
Gm15448 T A 7: 3,822,763 Y369F probably benign Het
Gm4763 T A 7: 24,724,197 N14I possibly damaging Het
Gm5141 T C 13: 62,774,132 T407A probably damaging Het
Gm5422 T C 10: 31,249,281 noncoding transcript Het
Greb1 T C 12: 16,696,456 Y1271C probably damaging Het
Hp1bp3 C A 4: 138,228,769 N50K possibly damaging Het
Hspg2 T C 4: 137,514,722 F589S probably damaging Het
Ido1 A G 8: 24,585,244 F183S probably damaging Het
Iqgap1 T A 7: 80,736,395 K936I probably damaging Het
Kdm4a T C 4: 118,175,689 D60G probably benign Het
L3mbtl4 G A 17: 68,774,291 C558Y probably damaging Het
Lrrc28 T C 7: 67,618,085 N98S probably damaging Het
Map1a A G 2: 121,302,783 D1360G probably benign Het
Megf10 C T 18: 57,277,724 P702S probably benign Het
Met A G 6: 17,491,710 E157G probably benign Het
Mff A G 1: 82,750,564 D187G possibly damaging Het
Mlph A T 1: 90,942,908 I514F possibly damaging Het
Mroh2a C T 1: 88,230,680 R150* probably null Het
Myo15b T C 11: 115,864,642 V976A probably benign Het
Myo9a A G 9: 59,871,926 D1655G probably benign Het
Ncoa6 C T 2: 155,391,211 G2059D probably benign Het
Ndst4 A T 3: 125,611,539 H481L possibly damaging Het
Nipbl A G 15: 8,303,480 S2220P probably benign Het
Nom1 C A 5: 29,435,311 P212T probably damaging Het
Nsd1 A G 13: 55,247,586 D1000G possibly damaging Het
Nudt9 T C 5: 104,050,601 F44S possibly damaging Het
Numb C T 12: 83,795,792 V537I probably damaging Het
Olfr1404 T A 1: 173,215,957 I102N possibly damaging Het
Olfr183 A G 16: 58,999,700 N5S probably damaging Het
Olfr60 A T 7: 140,345,632 M119K probably damaging Het
Olfr638 A G 7: 104,003,239 probably null Het
Olfr801 T A 10: 129,670,379 T47S probably benign Het
Osgin1 A T 8: 119,445,472 Y335F probably damaging Het
Pcdh10 T A 3: 45,379,764 V171E probably damaging Het
Plxna4 T C 6: 32,185,501 N1359S probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Prr5l T C 2: 101,772,290 T2A possibly damaging Het
Rbp3 T A 14: 33,958,648 I1069N possibly damaging Het
Rnf144b A G 13: 47,220,507 Y60C probably damaging Het
Sbno2 A T 10: 80,067,294 V396E probably damaging Het
Sdk1 A G 5: 141,954,958 T494A probably benign Het
Serac1 G T 17: 6,051,756 D384E probably damaging Het
Sgk1 A G 10: 21,882,657 N7D probably damaging Het
Sigirr A T 7: 141,093,067 V69D possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
St6gal2 T C 17: 55,498,289 Y396H probably benign Het
Ttn A T 2: 76,768,612 F19319Y probably damaging Het
Ubr4 T A 4: 139,401,326 I599N probably damaging Het
Vmn1r213 A G 13: 23,011,394 probably benign Het
Vmn2r96 T A 17: 18,597,568 M469K probably benign Het
Wasf1 T A 10: 40,931,906 probably null Het
Wdr20rt T C 12: 65,225,915 S51P probably damaging Het
Other mutations in Olfr1463
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Olfr1463 APN 19 13234739 missense probably benign 0.01
IGL02596:Olfr1463 APN 19 13234399 missense probably damaging 1.00
IGL03030:Olfr1463 APN 19 13235054 missense probably damaging 0.98
IGL03232:Olfr1463 APN 19 13234977 nonsense probably null
IGL03380:Olfr1463 APN 19 13235001 missense probably benign 0.00
PIT4382001:Olfr1463 UTSW 19 13234895 missense probably damaging 1.00
PIT4519001:Olfr1463 UTSW 19 13234852 missense probably benign 0.00
R0658:Olfr1463 UTSW 19 13235060 missense possibly damaging 0.94
R1181:Olfr1463 UTSW 19 13234831 missense probably benign 0.07
R1239:Olfr1463 UTSW 19 13234676 missense possibly damaging 0.80
R1316:Olfr1463 UTSW 19 13234439 missense probably damaging 1.00
R1465:Olfr1463 UTSW 19 13234901 missense possibly damaging 0.61
R1465:Olfr1463 UTSW 19 13234901 missense possibly damaging 0.61
R1900:Olfr1463 UTSW 19 13234913 missense possibly damaging 0.54
R1927:Olfr1463 UTSW 19 13235029 missense probably damaging 1.00
R2239:Olfr1463 UTSW 19 13234721 missense probably benign 0.00
R2380:Olfr1463 UTSW 19 13234721 missense probably benign 0.00
R3760:Olfr1463 UTSW 19 13234886 missense probably damaging 1.00
R3765:Olfr1463 UTSW 19 13234431 missense probably damaging 1.00
R3835:Olfr1463 UTSW 19 13234739 missense probably benign 0.18
R4690:Olfr1463 UTSW 19 13234768 missense possibly damaging 0.91
R4907:Olfr1463 UTSW 19 13234793 missense probably damaging 1.00
R5444:Olfr1463 UTSW 19 13234958 missense probably benign 0.28
R5465:Olfr1463 UTSW 19 13234688 missense probably benign 0.00
R6083:Olfr1463 UTSW 19 13234525 missense probably benign 0.01
R6259:Olfr1463 UTSW 19 13234421 missense probably damaging 0.98
R6324:Olfr1463 UTSW 19 13235104 missense possibly damaging 0.95
R6561:Olfr1463 UTSW 19 13235030 missense probably damaging 1.00
R6845:Olfr1463 UTSW 19 13234633 missense probably damaging 1.00
R7260:Olfr1463 UTSW 19 13235024 missense probably damaging 0.98
X0063:Olfr1463 UTSW 19 13234635 missense probably damaging 1.00
X0067:Olfr1463 UTSW 19 13234697 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCTGGGACTTACTGATGATCCAGGAC -3'
(R):5'- GCTCATTGATATGCCTATCCGAGCAAG -3'

Sequencing Primer
(F):5'- CCTCATCTACATTTTCACCCTGG -3'
(R):5'- TGTATCTCCAAGGTAAACTGAGACAC -3'
Posted On2013-07-30