Incidental Mutation 'R0654:Tmcc1'
ID62431
Institutional Source Beutler Lab
Gene Symbol Tmcc1
Ensembl Gene ENSMUSG00000030126
Gene Nametransmembrane and coiled coil domains 1
Synonyms
MMRRC Submission 038839-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.355) question?
Stock #R0654 (G1)
Quality Score121
Status Not validated
Chromosome6
Chromosomal Location116018611-116193486 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116042990 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 281 (H281Q)
Ref Sequence ENSEMBL: ENSMUSP00000145456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088896] [ENSMUST00000172510] [ENSMUST00000173110] [ENSMUST00000173140] [ENSMUST00000173548] [ENSMUST00000204353]
Predicted Effect unknown
Transcript: ENSMUST00000032222
AA Change: H500Q
SMART Domains Protein: ENSMUSP00000032222
Gene: ENSMUSG00000030126
AA Change: H500Q

DomainStartEndE-ValueType
low complexity region 153 164 N/A INTRINSIC
Pfam:Tmemb_cc2 268 677 9.7e-170 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088896
AA Change: H460Q

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000086285
Gene: ENSMUSG00000030126
AA Change: H460Q

DomainStartEndE-ValueType
low complexity region 156 167 N/A INTRINSIC
Pfam:Tmemb_cc2 227 636 2.3e-170 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172510
AA Change: H140Q

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000133665
Gene: ENSMUSG00000030126
AA Change: H140Q

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 1 188 6.5e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172909
SMART Domains Protein: ENSMUSP00000134407
Gene: ENSMUSG00000030126

DomainStartEndE-ValueType
low complexity region 14 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173110
SMART Domains Protein: ENSMUSP00000133794
Gene: ENSMUSG00000030126

DomainStartEndE-ValueType
low complexity region 156 167 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173140
AA Change: H140Q

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000134455
Gene: ENSMUSG00000030126
AA Change: H140Q

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 1 79 6.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173548
AA Change: H281Q

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000145456
Gene: ENSMUSG00000030126
AA Change: H281Q

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 48 457 1.5e-167 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204353
AA Change: H285Q

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000144971
Gene: ENSMUSG00000030126
AA Change: H285Q

DomainStartEndE-ValueType
Pfam:Tmemb_cc2 52 461 8.3e-171 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.5%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb13 A C 13: 3,642,092 H24P probably damaging Het
Avpr1b T A 1: 131,599,742 M1K probably null Het
Baz1a T C 12: 54,911,397 E1023G probably benign Het
Bpifb5 A G 2: 154,228,900 T204A probably benign Het
Cfap157 C T 2: 32,779,942 V210M probably damaging Het
Clock A G 5: 76,227,129 V731A possibly damaging Het
Cntn6 C T 6: 104,776,428 T447I probably benign Het
Dchs1 A G 7: 105,772,349 I288T probably damaging Het
Far2 T C 6: 148,175,141 F494S possibly damaging Het
Fibin T A 2: 110,362,617 D60V probably damaging Het
Fnd3c2 G A X: 106,247,154 T302I possibly damaging Het
Foxp3 A G X: 7,591,400 I281V probably benign Het
Fryl A G 5: 73,083,372 I1295T probably benign Het
Gpr82 T C X: 13,665,590 S126P probably benign Het
Gria4 T A 9: 4,464,372 Q530L probably benign Het
Hivep1 A C 13: 42,159,756 D1824A probably benign Het
Kif13a A G 13: 46,812,742 V400A possibly damaging Het
Map3k21 C A 8: 125,942,020 L782I probably benign Het
Nphs2 A C 1: 156,318,747 T98P probably damaging Het
Pdss2 CGGAG CG 10: 43,221,931 probably benign Het
Pkd2l1 A G 19: 44,157,631 probably null Het
Rbm28 A T 6: 29,128,578 S48R probably damaging Het
Rimkla C T 4: 119,477,980 V69M probably damaging Het
Scg3 T A 9: 75,665,735 I305F probably damaging Het
Slc22a1 T A 17: 12,662,792 N310I probably damaging Het
Slc26a9 T C 1: 131,765,030 V700A probably benign Het
Snx15 T C 19: 6,121,885 I140V probably benign Het
Spryd3 C T 15: 102,128,534 probably null Het
Srebf1 T C 11: 60,204,116 T486A probably benign Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tbl1xr1 T A 3: 22,203,994 probably null Het
Ttc39b T A 4: 83,241,701 M413L probably benign Het
Vmn2r101 C A 17: 19,590,111 H386Q probably benign Het
Zfp651 T C 9: 121,763,261 F251L probably benign Het
Other mutations in Tmcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Tmcc1 APN 6 116043027 missense probably damaging 0.99
IGL01580:Tmcc1 APN 6 116042985 missense possibly damaging 0.91
IGL02858:Tmcc1 APN 6 116133888 missense probably damaging 0.99
IGL03226:Tmcc1 APN 6 116133976 missense probably damaging 0.99
FR4976:Tmcc1 UTSW 6 116193380 start gained probably benign
IGL02988:Tmcc1 UTSW 6 116042928 missense probably damaging 1.00
R0522:Tmcc1 UTSW 6 116042870 frame shift probably null
R0721:Tmcc1 UTSW 6 116042870 frame shift probably null
R1392:Tmcc1 UTSW 6 116022110 missense possibly damaging 0.84
R1573:Tmcc1 UTSW 6 116133963 missense probably damaging 0.99
R1644:Tmcc1 UTSW 6 116133865 missense probably damaging 1.00
R2062:Tmcc1 UTSW 6 116043058 missense probably benign 0.01
R2065:Tmcc1 UTSW 6 116042870 frame shift probably null
R2214:Tmcc1 UTSW 6 116042870 frame shift probably null
R2240:Tmcc1 UTSW 6 116042870 frame shift probably null
R2399:Tmcc1 UTSW 6 116042870 frame shift probably null
R3683:Tmcc1 UTSW 6 116042870 frame shift probably null
R3722:Tmcc1 UTSW 6 116133822 missense possibly damaging 0.83
R3926:Tmcc1 UTSW 6 116042913 missense probably damaging 1.00
R4082:Tmcc1 UTSW 6 116043480 missense probably damaging 1.00
R4155:Tmcc1 UTSW 6 116133804 missense probably benign 0.18
R4619:Tmcc1 UTSW 6 116043286 missense probably damaging 1.00
R5246:Tmcc1 UTSW 6 116043420 missense probably damaging 1.00
R5568:Tmcc1 UTSW 6 116022110 missense possibly damaging 0.84
R6364:Tmcc1 UTSW 6 116043761 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GAGCTTCGCGTTAAAGTCATAAACTGG -3'
(R):5'- GAGAGATTGCCTCACTGATTCGGAAC -3'

Sequencing Primer
(F):5'- CTGACGAAAAACTCTTGTGGC -3'
(R):5'- TGGTAGTGCAGACAATATCCC -3'
Posted On2013-07-30